Rungsihirunrat, Muhamad, Chaijaroenkul, Kuesap, and Na-Bangchang: Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand
Cited By
Citations to this article as recorded by
Global scenario of Plasmodium vivax occurrence and resistance pattern
Davinder Kaur, Shweta Sinha, Rakesh Sehgal
Journal of Basic Microbiology.2022; 62(12): 1417.     CrossRef
Surveillance of drug resistance molecular markers in Plasmodium vivax before and after introduction of dihydroartemisinin and piperaquine in Thailand: 2009–2019
Nutnicha Suphakhonchuwong, Kanchana Rungsihirunrat, Jiraporn Kuesap
Parasitology Research.2023; 122(12): 2871.     CrossRef
Plasmodium vivax drug resistance markers: Genetic polymorphisms and mutation patterns in isolates from Malaysia
Fei-Wen Cheong, Shairah Dzul, Mun-Yik Fong, Yee-Ling Lau, Sasheela Ponnampalavanar
Acta Tropica.2020; 206: 105454.     CrossRef
Assessing the in vitro sensitivity with associated drug resistance polymorphisms in Plasmodium vivax clinical isolates from Delhi, India
Monika Matlani, Amit Kumar, Vineeta Singh
Experimental Parasitology.2021; 220: 108047.     CrossRef
The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
Kritpaphat Tantiamornkul, Tepanata Pumpaibool, Jittima Piriyapongsa, Richard Culleton, Usa Lek-Uthai
International Journal for Parasitology: Drugs and Drug Resistance.2018; 8(2): 229.     CrossRef
Monitoring Plasmodium vivax resistance to antimalarials: Persisting challenges and future directions
Marcelo U. Ferreira, Tais Nobrega de Sousa, Gabriel W. Rangel, Igor C. Johansen, Rodrigo M. Corder, Simone Ladeia-Andrade, José Pedro Gil
International Journal for Parasitology: Drugs and Drug Resistance.2021; 15: 9.     CrossRef
Genetic diversity of the Plasmodium vivax multidrug resistance 1 gene in Thai parasite populations
Veerayuth Kittichai, Wang Nguitragool, Huguette Gaelle Ngassa Mbenda, Jetsumon Sattabongkot, Liwang Cui
Infection, Genetics and Evolution.2018; 64: 168.     CrossRef
Genomic analysis of Plasmodium vivax describes patterns of connectivity and putative drivers of adaptation in Ethiopia
Alebachew Messele Kebede, Edwin Sutanto, Hidayat Trimarsanto, Ernest Diez Benavente, Mariana Barnes, Richard D. Pearson, Sasha V. Siegel, Berhanu Erko, Ashenafi Assefa, Sisay Getachew, Abraham Aseffa, Beyene Petros, Eugenia Lo, Rezika Mohammed, Daniel Yil
Scientific Reports.2023;[Epub]     CrossRef
Global assessment of genetic paradigms of Pvmdr1 mutations in chloroquine-resistant Plasmodium vivax isolates
Adel Spotin, Mahmoud Mahami-Oskouei, Ehsan Ahmadpour, Mahdi Parsaei, Ali Rostami, Shima Emami, Saba Gholipour, Mostafa Farmani
Transactions of The Royal Society of Tropical Medicine and Hygiene.2020; 114(5): 339.     CrossRef
Case report: recurrence of Plasmodium vivax malaria due to defective cytochrome P450 2D6 function in Pos Lenjang, Pahang, Malaysia
Noor Hafizan Mat Salleh, Mohd Faizal Abdul Rahman, Samsiah Samsusah, Jeremy Ryan De Silva, David Chun-Ern Ng, Azilawati Hanim Ghozali, Jia Hui Tan, Meng Yee Lai, Amirah Amir, Jonathan Wee Kent Liew, Yee Ling Lau
Transactions of The Royal Society of Tropical Medicine and Hygiene.2020; 114(9): 700.     CrossRef
Distinct Allelic Diversity of Plasmodium vivax Merozoite Surface Protein 3-Alpha (PvMSP-3α) Gene in Thailand Using PCR-RFLP
Kanyanan Kritsiriwuthinan, Warunee Ngrenngarmlert, Rapatbhorn Patrapuvich, Supaksajee Phuagthong, Kantima Choosang, Jianbing Mu
Journal of Tropical Medicine.2023; 2023: 1.     CrossRef
Evaluation of single nucleotide polymorphisms of pvmdr1 and microsatellite genotype in Plasmodium vivax isolates from Republic of Korea military personnel
Dong-Il Chung, Sookwan Jeong, Sylvatrie-Danne Dinzouna-Boutamba, Hye-Won Yang, Sang-Geon Yeo, Yeonchul Hong, Youn-Kyoung Goo
Malaria Journal.2015;[Epub]     CrossRef
Plasmodium vivax mdr1 genotypes in isolates from successfully cured patients living in endemic and non-endemic Brazilian areas
Larissa Rodrigues Gomes, Natália Ketrin Almeida-de-Oliveira, Aline Rosa de Lavigne, Suelen Rezende Félix de Lima, Anielle de Pina-Costa, Patrícia Brasil, Cláudio Tadeu Daniel-Ribeiro, Didier Ménard, Maria de Fatima Ferreira-da-Cruz
Malaria Journal.2016;[Epub]     CrossRef
Plasmodium vivax multidrug resistance-1 gene polymorphism in French Guiana
Emilie Faway, Lise Musset, Stéphane Pelleau, Béatrice Volney, Jessica Casteras, Valérie Caro, Didier Menard, Sébastien Briolant, Eric Legrand
Malaria Journal.2016;[Epub]     CrossRef
Genetic diversity of Plasmodium vivax metacaspase 1 and Plasmodium vivax multi-drug resistance 1 genes of field isolates from Mauritania, Sudan and Oman
Fatimata Sow, Guillaume Bonnot, Bilal Rabah Ahmed, Sidi Mohamed Diagana, Hachim Kebe, Mohamedou Koita, Ba Malado Samba, Said K. Al-Mukhaini, Majed Al-Zadjali, Seif S. Al-Abri, Osama A. M. Ali, Abdallah M. Samy, Muzamil Mahdi Abdel Hamid, Musab M. Ali Albs
Malaria Journal.2017;[Epub]     CrossRef
Clinical and molecular surveillance of drug resistant vivax malaria in Myanmar (2009–2016)
Myat Htut Nyunt, Jin-Hee Han, Bo Wang, Khin Myo Aye, Kyin Hla Aye, Seong-Kyun Lee, Ye Htut, Myat Phone Kyaw, Kay Thwe Han, Eun-Taek Han
Malaria Journal.2017;[Epub]     CrossRef
Measuring ex vivo drug susceptibility in Plasmodium vivax isolates from Cambodia
Suwanna Chaorattanakawee, Chanthap Lon, Soklyda Chann, Kheang Heng Thay, Nareth Kong, Yom You, Siratchana Sundrakes, Chatchadaporn Thamnurak, Sorayut Chattrakarn, Chantida Praditpol, Kritsanai Yingyuen, Mariusz Wojnarski, Rekol Huy, Michele D. Spring, Dou
Malaria Journal.2017;[Epub]     CrossRef
Molecular detection of drug resistant malaria in Southern Thailand
Chaturong Noisang, Christiane Prosser, Wieland Meyer, Waenurama Chemoh, John Ellis, Nongyao Sawangjaroen, Rogan Lee
Malaria Journal.2019;[Epub]     CrossRef
An unlabelled probe-based real time PCR and modified semi-nested PCR as molecular tools for analysis of chloroquine resistant Plasmodium vivax isolates from Afghanistan
Sayed Hussain Mosawi, Abdolhossein Dalimi, Najibullah Safi, Reza Fotouhi-Ardakani, Fatemeh Ghaffarifar, Javid Sadraei
Malaria Journal.2020;[Epub]     CrossRef
Molecular surveillance for drug resistance markers in Plasmodium vivax isolates from symptomatic and asymptomatic infections at the China–Myanmar border
Yan Zhao, Lin Wang, Myat Thu Soe, Pyae Linn Aung, Haichao Wei, Ziling Liu, Tongyu Ma, Yuanyuan Huang, Lynette J. Menezes, Qinghui Wang, Myat Phone Kyaw, Myat Htut Nyunt, Liwang Cui, Yaming Cao
Malaria Journal.2020;[Epub]     CrossRef
Molecular surveillance of the Plasmodium vivax multidrug resistance 1 gene in Peru between 2006 and 2015
Fredy E. Villena, Jorge L. Maguiña, Meddly L. Santolalla, Edwar Pozo, Carola J. Salas, Julia S. Ampuero, Andres G. Lescano, Danett K. Bishop, Hugo O. Valdivia
Malaria Journal.2020;[Epub]     CrossRef
Molecular epidemiology of potential candidate markers for chloroquine resistance in imported Plasmodium vivax malaria cases in Iran
Sakineh Pirahmadi, Shima Afzali, Akram Abouie Mehrizi, Abbasali Raz, Ahmad Raeisi
Malaria Journal.2023;[Epub]     CrossRef
Characteristics of molecular markers associated with chloroquine resistance in Plasmodium vivax strains from vivax malaria cases in Yunnan Province, China
Hongyun Ding, Ying Dong, Yan Deng, Yanchun Xu, Yan Liu, Jing Wu, Mengni Chen, Canglin Zhang, Weibin Zheng
Malaria Journal.2023;[Epub]     CrossRef
Nationwide spatiotemporal drug resistance genetic profiling from over three decades in Indian Plasmodium falciparum and Plasmodium vivax isolates
Loick P. Kojom Foko, Geetika Narang, Jahnvi Jakhan, Suman Tamang, Amit Moun, Vineeta Singh
Malaria Journal.2023;[Epub]     CrossRef
Polymorphisms of potential drug resistant molecular markers in Plasmodium vivax from China–Myanmar border during 2008‒2017
Zhensheng Wang, Chunyan Wei, Yunchun Pan, Zhihua Wang, Xin Ji, Qianqian Chen, Lianhui Zhang, Zenglei Wang, Heng Wang
Infectious Diseases of Poverty.2022;[Epub]     CrossRef
Promising approach to reducing Malaria transmission by ivermectin: Sporontocidal effect against Plasmodium vivax in the South American vectors Anopheles aquasalis and Anopheles darlingi
Yudi T. Pinilla, Stefanie C. P. Lopes, Vanderson S. Sampaio, Francys S. Andrade, Gisely C. Melo, Alessandra S. Orfanó, Nágila F. C. Secundino, Maria G. V. B. Guerra, Marcus V. G. Lacerda, Kevin C. Kobylinski, Karin S. Escobedo-Vargas, Victor M. López-Sifu
PLOS Neglected Tropical Diseases.2018; 12(2): e0006221.     CrossRef
Ex vivo susceptibilities of Plasmodium vivax isolates from the China-Myanmar border to antimalarial drugs and association with polymorphisms in Pvmdr1 and Pvcrt-o genes
Jiangyan Li, Jie Zhang, Qian Li, Yue Hu, Yonghua Ruan, Zhiyong Tao, Hui Xia, Jichen Qiao, Lingwen Meng, Weilin Zeng, Cuiying Li, Xi He, Luyi Zhao, Faiza A. Siddiqui, Jun Miao, Zhaoqing Yang, Qiang Fang, Liwang Cui, Kamala Thriemer
PLOS Neglected Tropical Diseases.2020; 14(6): e0008255.     CrossRef
Drug resistance markers in Plasmodium vivax isolates from a Kanchanaburi province, Thailand between January to May 2023
Thanawat Sridapan, Paweesuda Rattanakoch, Kaewkanha Kijprasong, Suttipat Srisutham, Kristan Alexander Schneider
PLOS ONE.2024; 19(7): e0304337.     CrossRef
Molecular Evidence of Drug Resistance in Asymptomatic Malaria Infections, Myanmar, 2015
Myat Htut Nyunt, Thinzar Shein, Ni Ni Zaw, Soe Soe Han, Fauzi Muh, Seong-Kyun Lee, Jin-Hee Han, Kyaw Zin Thant, Eun-Taek Han, Myat Phone Kyaw
Emerging Infectious Diseases.2017; 23(3): 517.     CrossRef
Ten-Year Molecular Surveillance of Drug-Resistant Plasmodium spp. Isolated From the China–Myanmar Border
Tongke Tang, Yanchun Xu, Long Cao, Penghai Tian, Jiang Shao, Yan Deng, Hongning Zhou, Bo Xiao
Frontiers in Cellular and Infection Microbiology.2021;[Epub]     CrossRef
Investigation of Mutations in the crt-o and mdr1 Genes of Plasmodium vivax for the Molecular Surveillance of Chloroquine Resistance in Parasites from Gold Mining Areas in Roraima, Brazil
Jacqueline de Aguiar Barros, Fabiana Granja, Rebecca de Abreu-Fernandes, Lucas Tavares de Queiroz, Daniel da Silva e Silva, Arthur Camurça Citó, Natália Ketrin Almeida-de-Oliveira Mocelin, Cláudio Tadeu Daniel-Ribeiro, Maria de Fátima Ferreira-da-Cruz
Microorganisms.2024; 12(8): 1680.     CrossRef
Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018
Chaturong Noisang, Wieland Meyer, Nongyao Sawangjaroen, John Ellis, Rogan Lee
Pathogens.2020; 9(2): 101.     CrossRef
Toxins from Animal Venoms as a Potential Source of Antimalarials: A Comprehensive Review
Zeca M. Salimo, André L. Barros, Asenate A. X. Adrião, Aline M. Rodrigues, Marco A. Sartim, Isadora S. de Oliveira, Manuela B. Pucca, Djane C. Baia-da-Silva, Wuelton M. Monteiro, Gisely C. de Melo, Hector H. F. Koolen
Toxins.2023; 15(6): 375.     CrossRef
Low Genetic Diversity of Plasmodium vivax Circumsporozoite Surface Protein in Clinical Isolates from Southern Thailand
Tachin Khulmanee, Thanyapit Thita, Kanyanan Kritsiriwutinan, Usa Boonyuen, Aminoh Saai, Kanjana Inkabjan, Rimi Chakrabarti, Pradipsinh K. Rathod, Srivicha Krudsood, Mathirut Mungthin, Rapatbhorn Patrapuvich
Tropical Medicine and Infectious Disease.2024; 9(5): 94.     CrossRef
Genetic Diversity of Plasmodium vivax Merozoite Surface Protein-3 Alpha and Beta from Diverse Geographic Areas of Thailand
Jiraporn Kuesap, Kanchana Rungsihirunrat, Wanna Chaijaroenkul, Mathirut Mungthin
Japanese Journal of Infectious Diseases.2022; 75(3): 241.     CrossRef

Abstract

The aim of the study was to explore the possible molecular markers of chloroquine resistance in Plasmodium vivax isolates in Thailand. A total of 30 P. vivax isolates were collected from a malaria endemic area along the Thai-Myanmar border in Mae Sot district of Thailand. Dried blood spot samples were collected for analysis of Pvmdr1 and Pvcrt-o polymorphisms. Blood samples (100 μl) were collected by finger-prick for in vitro chloroquine susceptibility testing by schizont maturation inhibition assay. Based on the cut-off IC50 of 100 nM, 19 (63.3%) isolates were classified as chloroquine resistant P. vivax isolates. Seven non-synonymous mutations and 2 synonymous were identified in Pvmdr1 gene. Y976F and F1076L mutations were detected in 7 (23.3%) and 16 isolates (53.3%), respectively. Analysis of Pvcrt-o gene revealed that all isolates were wild-type. Our results suggest that chloroquine resistance gene is now spreading in this area. Monitoring of chloroquine resistant molecular markers provide a useful tool for future control of P. vivax malaria.

INTRODUCTION

Chloroquine has been used as the first-line treatment for Plasmodium vivax since 1946 [1]. Treatment failure of chloroquine in P. vivax has, however, been increasing in some malaria endemic countries. The resistance was first reported in Papua New Guinea [2], and was subsequently reported in several countries in Asia [3-8]. In Thailand, reduced in vitro parasite’s susceptibility to chloroquine, as well as mefloquine, amodiaquine, and artesunate has been demonstrated in the western border of Thailand [9]. Nevertheless, the drug remains to be the standard treatment for P. vivax in the country due to its clinical effectiveness and affordability. Although the molecular mechanisms underlying chloroquine resistance in P. vivax remain unclear, similar molecular mechanisms of multi-loci genes in P. falciparum have been proposed to be involved in P. vivax chloroquine resistant phenotype.
The P. vivax multidrug resistance (Pvmdr) and putative transporter protein (Pvcrt-o), which are orthologous to Pfmdr1 and Pfcrtgenes, have been identified as chloroquine resistance markers in P. vivax. The mutant alleles of both genes were suggested to be associated with chloroquine resistance in P. vivax in Southeast Asia both in vivo and in vitro [10-12]. Analysis of the complete sequences of the Pvmdr1 and Pvcrt-o in P. vivax isolates from Brazilian Amazon region demonstrated that Pvmdr1 gene contained 24 single nucleotide polymorphisms (SNPs), whereas Pvcrt-o gene contained 5 SNPs and lysine insertion at the amino acid position 10 [13]. The analysis of Pvmdr1 SNPs at homologous positions of Pfmdr1 did not reveal any polymorphism as that found in P. falciparum [11,14,15]. It is possible that the mechanisms of chloroquine resistance in P. vivax may differ from that in P. falciparum. The aim of the present study was to investigate whether chloroquine resistance genes of P. vivax (Pvmdr1 and Pvcrt-o) have already spread in malaria endemic areas of Thailand, and whether their chloroquine resistance phenotypes were associated with in vitro drug susceptibility.

MATERIALS AND METHODS

Sample collection

The study was conducted at malaria clinic, Mae Sot, Tak Province, Thailand, during April to August 2010. This malaria endemic area is located along the Thai-Myanmar border, which is well-documented as an area of multidrug resistance P. falciparum [16,17]. The study protocol was reviewed and approved by the Ethics Review Committee for Research Involving Human Research Subject, Health Science Group, Chulalongkorn University, Thailand. Written informed consent for study participation was obtained from each patient prior to participation. Inclusion criteria included P. vivax parasitemia of 1,000-100,000 parasites/μl blood, absence of signs of severe diseases, and no previous antimalarial treatment during the preceding 4 weeks. Blood films were stained with Giemsa and examined by a light microscope. Asexual stages of P. vivax were counted against 1,000 erythrocytes in thin blood films or against 200 white blood cells in thick films and 70% of dominant ring stage were selected for in vitro assay. Two hundred micro-liters of blood samples were spotted onto a filter paper and stored in small plastic zip lock bags prior to the extraction of parasite DNA for identification of PvmdrI and Pvcrt-o polymorphisms. Blood samples (1 μl each) were collected into sodium heparinized tube prior to treatment with a 3-day chloroquine for in vitro drug susceptibility assay.

In vitro schizont maturation inhibition assay

The schizont maturation assay was performed with all P. vivax isolates according to the modified method of Russell et al. [18]. Briefly, plasma and buffy coat were separated from blood samples by centrifugation and packed red cells were washed twice with RPMI 1640 medium. The pellets were resuspended in human AB serum to obtain 40% hematocrit, and were then diluted to 4% in McCoy’s 5A medium containing 30% AB serum. Drug plates were prepared fresh to avoid possible degradation. A stock solution of each drug was prepared in 1% dimethyl sulfoxide (DMSO), and was subsequently diluted in RPMI 1640 medium to obtain the desired drug concentrations. Fifty microliters of the working drug (chloroquine phosphate: Liverpool School of Tropical Medicine, Liverpool, UK) solution in RMPI 1640 medium, at the concentrations ranging from 0-10,000 nM were added into each well of 96 well plates. Well A was free of drug and served as a control, whereas wells B-H contained ascending concentrations of chloroquine, each concentration of which was tested in triplicate. The tested plate was incubated at 37.5˚C in a candle jar for 24-36 hr depending on the stages of the parasite before culturing. After incubation, the plate was placed in semi-vertical position for 15 min, and then a thick blood film was prepared from the pellets of each well. The number of normal schizonts (containing>8 nuclei) per 200 asexual stage parasites of control well and each drug containing well was counted and expressed as the percentage of schizont maturation inhibition. The dose-response curve was analyzed using CalcuSyn™ software (BioSoft, Cambridge, UK) to obtain the IC50 values (the concentrations that inhibit schizont maturation by 50% compared with the control).

Identification of PvmdrI and Pvcrt-o polymorphisms

Genomic DNA was individually extracted from dried blood spots on filter paper using a QIAamp DNA extraction mini-kit (Qiagen, Hilden, Germany) and used as the template for amplification by PCR. The PvmdrI and Pvcrt-o genes were amplified by nested PCR using specific primers [10,15] (Table 1). Pvmdr1 and Pvcrt-o were first amplified with a pair of outer primers; mdrF-mdrR and crtF-crtR, respectively. The outer PCR was carried out in a total volume of 20 μl in the following reaction mixture: 0.2 μM of each primer, 2.5 mM MgCl2, 100 mM KCl, 20 mM Tris-HCl, pH 8.0, 100 μM deoxynucleotides (dNTPs), 1-2 μl of genomic DNA, and 0.5 unit of Taq DNA polymerase. The PCR cycling parameters were as follows: initial denaturation at 95˚C for 5 min, followed by 35 cycles at 95˚C for 30 sec, 60˚C for 30 sec, 72˚C for 30 sec, and then followed by final extension at 72˚C for 5 min. The Pvmdr1 gene was amplified by nested or semi-nested PCR using 6 pairs of primers as follows: mdrF-mdr1R, mdr2F-mdr2R, mdr3F-mdr3R, mdr4F-mdr4R, mdr5F- mdr5R, and mdr6F-mdrR. The Pvcrt-o gene was amplified by nested PCR using a pair of primers: crtF-crtR.
The nested PCR was carried out in a total volume of 50 μl in the following reaction mixture: 0.2 μM of each primer, 2.5 mM MgCl2, 100 mM KCL, 20 mM Tris-HCl, pH 8.0, 100 μM deoxynucleotides (dNTPs), 1 μl of first PCR product, and 0.5 unit of Taq DNA polymerase. The PCR cycling parameters were as follows: initial denaturation at 95˚C for 5 min, followed by 35 cycles at 95˚C for 30 sec, 55˚C for 30 sec, 72˚C for 30 sec, and then followed by final extension at 72˚C for 5 min. The PCR products were fractioned by 1.5% agarose gel electrophoresis, purified with QIAquick PCR purification kit (Qiagen), and sequenced by automated DNA sequencer (ABI system, Singapore). Each fragment was sequenced in both the forward and reverse directions and assembled using Bioedit version 7.1.3. DNA fragments were aligned using the ClustalW multiple sequence alignment. Amino acid sequence alignments of all isolates were compared with the wild-type sequence from GenBank for Pvmdr1 (accession no. AY618622) and Pvcrt-o (accession no. AF314649) using Bioedit version 7.1.3 (Ibis BioSciences, Carlsbad, California, USA).

Data analysis

The IC50 are presented as median (range) values. The association between Pvmdr1 polymorphisms and in vitro susceptibilities of the parasite isolates to chloroquine was assessed by Mann-Whitney U test and chi-square test. Statistical significance level was set at P=0.05 for all tests (SPSS version 12).

RESULTS

In vitro susceptibilities of parasite isolates

A total of 30 P. vivax isolates were successfully evaluated for their susceptibilities to chloroquine by schizont maturation inhibition assay. The median (range) IC50 was 134.7 (1.1-264.9) nM. Based on the cut-off IC50 of 100 nM, 19 isolates (63.3%) were classified as chloroquine resistant isolates.

Analysis of Pvmdr1 gene polymorphisms

The Pvmdr1 gene was successfully sequenced in 30 P. vivax isolates. Analysis of Pvmdr1 sequence showed absence of mutations at the amino acid residues 91, 189, 1,071, 1,079, and 1,291, corresponding to the amino acid residues 86, 184, 1,034, 1,042, and 1,246 of the Pvmdr1 gene, respectively. Seven non-synonymous mutations were identified, i.e., S513R (agt/aga) (23.3%), S515R (agc/agg) (100%), G698S (ggc/agc) (100%), M908L (atg/ctg) (100%), T958M (acg/atg) (100%), Y976F (tac/ttc) (23.3%), and F1076L (ttt/ctt)(53.3%). Two synonymous mutations at the amino acid residues T529 (acg=90%) or T529 (aca=10%), and L1022 (cta) (100%) were also identified (Table 2). Five haplotypes of Pvmdr1 were observed, of which the majority of the isolates (14/30) carried 5 mutations (513R+515R+698S+908L+958M and 515R+ 698S+908L+958M+1,076L). Isolates carrying 4 mutations (515R+698S+908L+958M) and 6 mutations (513R+515R+698S+908L+958M+1,076L and 515R+698S+908L+958M+976F+1,076L) were found in equal frequency (8/30). Isolates carrying 1,076L were observed in 16 isolates (53.3%), whereas isolates carrying both 976F+1,076L were observed in 7 isolates (23.3%).

Analysis of Pvcrt-o gene polymorphisms

The Pvcrt-o gene was successfully sequenced in all 30 isolates. All isolates carried wild-type Pvcrt-o gene.

Association between gene polymorphisms and chloroquine susceptibility

Fifteen P. vivax isolates were randomly selected for the analysis of in vitro susceptibility to chloroquine together with Pvmdr1 and Pvcrt-o polymorphisms (Table 3). There was no significant correlation between polymorphism of pvmdr1 and chloroquine IC50 values (Mann-Whitney U test, P>0.05). Based on the cut-off IC50 of 100 nM, the frequencies of pvmdr1 polymorphisms of all P. vivax isolates classified according to in vitro susceptibility to chloroquine are summarized in Table 4. No association between polymorphism of Pvmdr1 and chloroquine susceptibility was found.

DISCUSSION

Chloroquine resistance in P. vivax has been reported since 1989 in Indonesia and further sporadic cases were subsequently observed in other Asian countries. In Thailand, the proportion of P. vivax infection has become increasing and a trend of gradual decline of in vitro sensitivity to chloroquine has been reported in some areas [19]. There has been, however, no evidence of clinical resistance of P. vivax to chloroquine until the recent report of first clinically and laboratory confirmed case of high grade chloroquine resistant P. vivax in a pregnant woman from the western border of Thailand [20]. Monitoring of the efficacy of chloroquine in P. vivax is essential for earlier warning system and expedites the appropriate drug policy. Various in vitro assay systems with different endpoint criteria have been applied for monitoring of sensitivity of P. vivax isolates to antimalarial drugs. Although the monitoring of drug susceptibility based on the in vitro schizont maturation assay is more complicated in P. vivax compared with P. falciparum due to the lack of a continuous cultivation system and the asynchronous blood stage of the parasite, the assay remains the gold standard method for assessing the antimalarial drug efficacy. The assay has been applied for assessing P. vivax sensitivity to antimalarial drugs with relatively low success rate compared with P. falciparum. The in vitro cut-off IC50 of 100 nM for P. falciparum was used to define chloroquine resistance, but this cut-off has never been clearly defined for P. vivax. Based on this defined cut-off value, a total of 19 P. vivax isolates (63.3%) included in our current study were classified as chloroquine resistance. These results indicate an increasing prevalence of chloroquine resistant isolates in the western border of Thailand. In a previous study, Suwanarusk et al. [10] defined the cut-off IC50 of 220 nM based on the 35th percentile of the clinical failure rate of 65% observed in Indonesian and Thai patients (from Mae Sot District) with P. vivax malaria. The sensitivity of P. vivax isolates collected from Thailand were found to be significantly lower than that of the Indonesian isolates (geometric mean IC50 of 46.8 nM in Thai isolates compared to 312 nM in Indonesian isolates). Eleven out of 81 (13.6%) Thai isolates exhibited IC50 of chloroquine over 220 nM [10]. Using this defined criteria, about 20% (6 isolates) of P. vivax collected in the present study exhibited IC50 values over this threshold.
Unlike chloroquine resistant P. falciparum, the mechanisms of chloroquine resistance in P. vivax remains unclear. The orthologous P. falciparum genes linked to chloroquine resistance have been used to identify chloroquine resistance gene in P. vivax. Association between the in vitro sensitivity and the polymorphisms of Pvmdr1 and Pvcrt-o as markers of chloroquine resistance were investigated in the present study. The Pvmdr1 gene was found to be more polymorphic than Pvcrt, of which 7 non-synonymous and 2 synonymous mutations were observed. Pvmdr1 Y976F mutation which has been identified as a possible genetic marker for chloroquine resistance in P. vivax was detected only in 7 out of 30 (23.3%) P. vivax isolates. This observed frequency of mutation is in concordance with the results from in vitro drug susceptibility test revealing that 6 isolates (20%) were chloroquine resistant based on the cut-off IC50 of 220 nM. In a previous study, the mutations at Y976F and F1076L were detected in 17% and 21%, respectively in P. vivax Thai isolates [11].
The observation of high frequency of F1076L (53.3%) mutation in our present study was similar to that reported in a previous study in isolates from Papua New Guinea. The frequency of Y976F Pvmdr1 mutation was much lower than the Papua New Guinea isolates (53.3% vs 100%), while none was found in the isolates collected from Korea [12]. The frequency of single mutation at Y976F or F1076L (76.6%) observed in our study was higher than the double (Y976F+F1076L) (23.3%) mutant. In another study on P. vivax isolates collected from Thailand, Indonesia, Turkey, Azerbaijan, and French Guyana, this Y976F and F1076L mutation of the pvmdr1 gene were found at a relatively high frequency of 60.8% (14 of 23 P. vivax isolates), of which 5 isolates (21.7%) was observed in the isolates collected from Thailand, 4 from Azerbaijan, 3 from Turkey, and 2 from Indonesia. Altogether, results may suggest that Y976F and F1076L mutations in P. vivax were spread and distributed from Southeast Asia and high prevalence of F1076L mutation may indicate the trend of rapid aggravation of chloroquine resistance P. vivax in this region. However, no association between polymorphisms of Pvmdr1 and chloroquine susceptibility was observed in our study. This could be due to the limitation of the number of samples included in the analysis. In a clinical study in Madagascar, no significant association between the Pvmdr1 Y976F mutation and chloroquine treatment outcome of P. vivax was also reported [15]. In another study, however, the sensitivity to chloroquine was shown to be significantly higher (1.7 fold) in P. vivax isolates from Thailand and Indonesia which carried the Y976F mutation but not with that increased Pvmdr1 copy number, compared with the wild type isolates [10]. Although other molecular determinants may also be involved with chloroquine resistance in P. vivax, Y976F and F1076L mutations could be used as reliable molecular markers for monitoring the occurrence and spread of chloroquine resistance in P. vivax in Thailand.
Apart from the mutations at both codons, 2 non-synonymous mutations at codon T529 (aca=10%, acg=90%) and L1022 (cta=100%) were also detected in the P. vivax isolates collected in the current study. The commonly found mutations at codon S515R, G698S, M908L, and T958M were also detected in all isolates. Sequence analysis of Pvmdr1 gene has shown no mutation at codons 91, 189, 1,071, 1,079, and 1,291 homologous to Pfmdr1 at codons 86, 184, 1,034, 1,042, and 1,246, respectively, which are associated with chloroquine resistance in P. falciparum. The majority of isolates (46.6%) carried 5 mutations, whereas 26.7% carried 4 and 6 mutations in Pfmdr1 gene, respectively. It is interesting that polymorphism in Pfmdr1 gene was higher than Pfmdr1 gene which might be a factor that contributed to in vitro resistance parasites.
Unlike P. falciparum of which mutation of Pfcrt gene are closely linked with parasite’s resistance to chloroquine, the role of the polymorphisms of this gene in conferring chloroquine resistance may be limited to P. falciparum. Point mutations in Pfcrt gene especially K76T are strongly associated with chloroquine resistance phenotype in P. falciparum [21]. However, chloroquine resistance in P. vivax does not seem to involve Pvcg10, the P. vivax ortholog of Pfcrt [22]. Only wild-type Pvcrt-o was detected in our samples, which is similar to that found in the isolates from Madagascar [15]. Identification of difference in the orthologous gene of P. falciparum and P. vivax is important for comparison of genetic determinants of chloroquine resistance in both malaria species. The mechanism of chloroquine resistance is probably similar in both P. falciparum and P. vivax, but the development of resistance may be different in these 2 malaria species.

ACKNOWLEDGEMENTS

The study was supported by Chulalongkorn University Centenary Academic Development Project, and the Office of Commission on Higher Education (RG and NRU Projects), Ministry of Education of Thailand. We thank the patients who participated in this study and the staff of the Mae Sot General Hospital and Section 4, Vector Borne Disease Control, Mae Sot District, Tak Province for their kind assistance during blood sample collection.

CONFLICTS OF INTEREST

We have no conflict of interest related to this work.

REFERENCES

1. World Health Organization. The use of antimalarial drugs. Report of a WHO informal consultation. Report WHO/CDS/RBM/2001.33. Geneva, Switzerland. World Health Organization. 2001.

2. Rieckmann KH, Davis DR, Hutton DC. Plasmodium vivax resistance to chloroquine? Lancet 1989;2:1183-1184.
crossref pmid
3. Baird JK, Basri H, Bangs MJ, Subianto B, Patchen LC, Hoffman SL. Resistance to chloroquine by Plasmodium vivax in Irian Jaya, Indonesia. Am J Trop Med Hyg 1991;44:547-552.
pmid
4. Marlar Than, Myat Phone-KyawL, Aye Yu-Sue, Khaing Khaing-Gyi, Ma Sabai, Myint Oo. Development of resistance to chloroquine by Plasmodium vivax in Myanmar. Trans R Soc Trop Med Hyg 1995;89:307-308.
crossref
5. Baird JK, Sustriayu Nalim MF, Basri H, Masbar S, Leksana B, Tjitra E, Dewi RM, Khairani M, Wignall FS. Survey of resistance to chloroquine by Plasmodium vivax in Indonesia. Trans R Soc Trop Med Hyg 1996;90:409-411.
crossref
6. Dua VK, Kar PK, Sharma VP. Chloroquine resistant Plasmodium vivax malaria in India. Trop Med Int Health 1996;1:816-819.
crossref pmid
7. Phan GT, de Vries PJ, Tran BQ, Le HQ, Nguyen NV, Nguyen TV, Heisterkamp SH, Kager PA. Artemisinin or chloroquine for blood stage Plasmodium vivax malaria in Vietnam. Trop Med Int Health 2002;7:858-864.
crossref pmid
8. Lee KS, Kim TH, Kim ES, Lim HS, Yeom JS, Jun G, Park JW. Short report: chloroquine-resistant Plasmodium vivax in the Republic of Korea. Am J Trop Med Hyg 2009;80:215-217.
pmid
9. Chotivanich K, Udomsangpetch R, Chierakul W, Newton PN, Ruangveerayuth R, Pukrittayakamee S, Looareesuwan S, White NJ. In vitro efficacy of antimalarial drugs against Plasmodium vivax on the western border of Thailand. Am J Trop Med Hyg 2004;70:395-397.
pmid
10. Suwanarusk R, Russell B, Chavchich M, Chalfein F, Kenangalem E, Kosaisavee V, Prasetyorini B, Piera KA, Barends M, Brockman A, Lek-Uthai U, Anstey NM, Tjitra E, Nosten F, Cheng Q, Price RN. Chloroquine resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms. PLoS One 2007;2:e1089.
crossref pmid pmc
11. Brega S, Meslin B, de Monbrison F, Severini C, Gradoni L, Udomsangpetch R, Sutanto I, Peyron F, Picot S. Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity. J Infect Dis 2005;191:272-277.
crossref pmid
12. Lu F, Lim CS, Nam DH, Kim K, Lin K, Kim TS, Lee HW, Chen JH, Wang Y, Sattabongkot J, Han ET. Genetic polymorphism in pvmdr1 and pvcrt-o genes in relation to in vitro drug susceptibility of Plasmodium vivax isolates from malaria-endemic countries. Acta Trop 2011;117:69-75.
crossref pmid
13. Orjuela-Sánchez P, de Santana Filho FS, Machado-Lima A, Chehuan YF, Costa MR, Alecrim MG, del Portillo HA. Analysis of single-nucleotide polymorphisms in the crt-o and mdr1 genes of Plasmodium vivax among chloroquine-resistant isolates from the Brazilian Amazon region. Antimicrob Agents Chemother 2009;53:3561-3564.
crossref pmid pmc
14. Sá JM, Nomura T, Neves JD, Baird JK, Wellems TE, del Portillo HA. Plasmodium vivax: allele variants of the mdr1 gene do not associate with chloroquine resistance among isolates from Brazil, Papua, and monkey-adapted strains. Exp Parasitol 2005;109:256-259.
crossref pmid
15. Barnadas C, Ratsimbasoa A, Tichit M, Bouchier C, Jahevitra M, Picot S, Ménard D. Plasmodium vivax resistance to chloroquine in Madagascar: clinical efficacy and polymorphisms in pvmdr1 and pvcrt-o genes. Antimicrob Agents Chemother 2008;52:4233-4240.
crossref pmid pmc
16. Wongsrichanalai C, Sirichaisinthop J, Karwacki JJ, Congpuong K, Miller RS, Pang L, Thimasarn K. Drug resistant malaria on the Thai-Myanmar and Thai-Cambodian borders. Southeast Asian J Trop Med Public Health 2001;32:41-49.
pmid
17. Wongsrichanalai C, Pickard AL, Wernsdorfer WH, Meshnick SR. Epidemiology of drug-resistant malaria. Lancet Infect Dis 2002;2:209-218.
crossref pmid
18. Russell BM, Udomsangpetch R, Rieckmann KH, Kotecka BM, Coleman RE, Sattabongkot J. Simple in vitro assay for determining the sensitivity of Plasmodium vivax isolates from fresh human blood to antimalarials in areas where P. vivax is endemic. Antimicrob Agents Chemother 2003;47:170-173.
crossref pmid pmc
19. Congpuong K, Na-Bangchang K, Thimasarn K, Tasanor U, Wernsdorfer WH. Sensitivity of Plasmodium vivax to chloroquine in Sa Kaeo Province, Thailand. Acta Trop 2002;83:117-121.
crossref pmid
20. Rijken MJ, Boel ME, Russell B, Imwong M, Leimanis ML, Phyo AP, Muehlenbachs A, Lindegardh N, McGready R, Renia L, Snounou G, Singhasivanon P, Nosten F. Chloroquine resistant vivax malaria in a pregnant woman on the western border of Thailand. Malar J 2011;10:113.
crossref pmid pmc
21. Fidock DA, Nomura T, Talley AK, Cooper RA, Dzekunov SM, Ferdig MT, Ursos LM, Sidhu AB, Naude B, Deitsch KW, Su XZ, Wootton JC, Roepe PD, Wellems TE. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell 2000;6:861-871.
crossref
22. Nomura T, Carlton JM, Baird JK, del Portillo HA, Fryauff DJ, Rathore D, Fidock DA, Su X, Collins WE, McCutchan TF, Wootton JC, Wellems TE. Evidence for different mechanisms of chloroquine resistance in 2 Plasmodium species that cause human malaria. J Infect Dis 2001;183:1653-1661.
crossref pmid

Table 1.
List of PCR primers for amplification of PvmdrI and Pvcrt-o genes
Primer Sequence 5’ to 3’ nt position
Outer primer: mdrF: TTGAACAAGAAGGGGACGTT 82-101
mdrR: CTTATATACGCCGTCCTGCAC 4371-4351
crtF:GCTACCCCTAACGCACAATG -17-3
crtR: GATTTGGGAAAGCACAACGT 1853-1834
Nested primer: mdr1R:GCGTAAGATGCTAAAATGAACC 887-866
mdr2F:ATTTAACCTTTCAGAAAAGCTGT 783-805
mdr2R: CCACCTGACAACTTAGATGC 1748-1729
mdr3F: CTGATACAAGTGAGGAAGAACTAC 1600-1623
mdr3R: ACTATCCTGGTCAAAAAAGC 1757-1738
mdr4F: CCCTCTACATCTTAGTCATCG 2600-2620
mdr4R: TGGTCTGGACAAGTATCTAAAA 3531-3510
mdr5F: GGATAGTCATGCCCCAGGATTG 2751-2772
mdr5R: CATCAACTTCCCGGCGTAGC 3354-3335
mdr6F: GGAAGTTGATGTCCCTAAAGG 3344-3364
crtF:GATGAACGTTACCGGGAGTTGG 49-70
crtR: ATCGGAAGCATCAGGCAGGA 1772-1751
Table 2.
Frequency distribution of mutation at each codon and haplotype in Pvmdr1 gene of 30 P. vivax isolates
Amino acid residue at the codon indicated No. (%) of isolates with Pvmdr1 mutant alleles
S513R (agt/aga) 7 (23.3)
S515R (agc/agg) 30 (100)
T529 (aca/acg) T529 (aca) = 3 (10.0), T529 (acg) = 27 (90.0)
G698S (ggc/agc) 30 (100)
M908L (atg/ctg) 30 (100)
T958M (acg/atg) 30 (100)
Y976F (tac/ttc) 7 (23.3)
L1022 (cta/tta) L1022 (cta) = 30 (100)
F1076L (ttt/ctt) 16 (53.3)
Frequency distribution of the 5 haplotypes in Pvmdr1
 - 515R+ 698S+ 908L+ 958M (4 mutations) 8 (26.7)
 - 513R+ 515R+ 698S+ 908L+ 958M (5 mutations) 6 (20.0)
 - 515R+ 698S+ 908L+ 958M+ 1,076L (5 mutations) 8 (26.7)
 - 513R+ 515R+ 698S+ 908L+ 958M+1,076L (6 mutations) 1 (3.3)
 - 515R+ 698S+ 908L+ 958M + 976F+ 1,076L (6 mutations) 7 (23.3)
Table 3.
The polymorphisms in Pvmdr1 gene at the 4 highly polymorphic loci (S513R, Y976F, F1076L, and T529) including the other 5 loci and IC50 values of 15 selected P. vivax isolates with wild-type and mutant genotypes
Median (range) Chloroquine IC50 (nM)
S513R S (n=12) 132.56 (39.99-243.17)
R (n=3) 141.99 (81.86-248.86)
S515R R (n=15) 137.04 (39.99-248.86)
T529 T (aca) (n=1) 43.24
T (acg) (n=14) 139.52 (39.99-248.86)
G698S S (n=15) 137.04 (39.99-248.86)
M908L L (n=15) 137.04 (39.99-248.86)
T958M M (n=15) 137.04 (39.99-248.86)
Y976F Y (n=13) 137.04 (39.99-248.86)
F (n=2) 165.19 (87.21-243.17)
L1022 L (cta) (n=15) 137.04 (39.99-248.86)
F1076L F (n=6) 119.41 (39.99-248.86)
L (n=9) 137.04 (43.24-243.17)

Data are presented as number of isolates (n) and median (range) IC50 values.

Table 4.
The association between polymorphisms in Pvmdr1 gene at the 4 highly polymorphic loci (S513R, Y976F, F1076L, T529) including the other 5 loci and in vitro susceptibilities of 15 selected P. vivax isolates to chloroquine classified based on the in vitro IC50 cut-off of 100 nM
Chloroquine resistant Chloroquine sensitive
S513R S 7 5
R 2 1
S515R R 6 9
T529 T (aca) 0 1
T (acg) 9 5
G698S S 9 6
M908L L 9 6
T958M M 9 6
Y976F F 1 1
Y 8 5
L1022 L (cta) 9 6
F1076L F 3 3
L 6 3

Data are presented as number of isolates (n).

1