Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Proteomic Analysis of Toxoplasma gondii KI-1 Tachyzoites

The Korean Journal of Parasitology 2010;48(3):195-201.
Published online: September 16, 2010

1Department of Ophthalmology, Chungnam National University School of Medicine, Daejeon 301-747, Korea.

2Department of Infection Biology and Research Institute for Medical Sciences, Chungnam National University School of Medicine, Daejeon 301-747, Korea.

3Medical Proteomics Research Laboratory, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-333, Korea.

4Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, Seoul 110-799, Korea.

Corresponding author (yhalee@cnu.ac.kr)

These authors contributed equally to this work.


Kim TY's present address: Department of Environmental Medical Biology and Institute of Tropical Medicine, Yonsei University College of Medicine, Seoul, Korea.

• Received: July 18, 2010   • Revised: August 11, 2010   • Accepted: August 12, 2010

Copyright © 2010 by The Korean Society for Parasitology

  • 10,108 Views
  • 88 Download
  • 10 Crossref
  • 11 Scopus
next

Citations

Citations to this article as recorded by  Crossref logo
  • Prophylactic antineoplastic activity of Toxoplasma gondii RH derived antigen against ehrlich solid carcinoma with evidence of shared antigens by comparative immunoblotting
    Maha M. Eissa, Maha R. Gaafar, Layla K. Younis, Cherine A. Ismail, Nahla El Skhawy
    Infectious Agents and Cancer.2023;[Epub]     CrossRef
  • Mining the Proteome of Toxoplasma Parasites Seeking Vaccine and Diagnostic Candidates
    Sajad Rashidi, Javier Sánchez-Montejo, Reza Mansouri, Mohammad Ali-Hassanzadeh, Amir Savardashtaki, Mohammad Saleh Bahreini, Mohammadreza Karimazar, Raúl Manzano-Román, Paul Nguewa
    Animals.2022; 12(9): 1098.     CrossRef
  • Unraveling Toxoplasma gondii GT1 Strain Virulence and New Protein-Coding Genes with Proteogenomic Analyses
    Neelam Antil, Manish Kumar, Santosh Kumar Behera, Mohammad Arefian, Chinmaya Narayana Kotimoole, Devasahayam Arokia Balaya Rex, Thottethodi Subrahmanya Keshava Prasad
    OMICS: A Journal of Integrative Biology.2021; 25(9): 591.     CrossRef
  • iTRAQ-Based Global Phosphoproteomics Reveals Novel Molecular Differences Between Toxoplasma gondii Strains of Different Genotypes
    Ze-Xiang Wang, Chun-Xue Zhou, Guillermo Calderón-Mantilla, Evangelia Petsalaki, Jun-Jun He, Hai-Yang Song, Hany M. Elsheikha, Xing-Quan Zhu
    Frontiers in Cellular and Infection Microbiology.2019;[Epub]     CrossRef
  • Immunoproteomic technology offers an extraordinary diagnostic approach for Toxoplasma gondii infection
    Saeed El-Ashram, Qing Yin, John R. Barta, Jamal Khan, Xianyong Liu, Xun Suo
    Journal of Microbiological Methods.2015; 119: 18.     CrossRef
  • Exploring Early and Late Toxoplasma gondii Strain RH Infection by Two-Dimensional Immunoblots of Chicken Immunoglobulin G and M Profiles
    Saeed El-Ashram, Ximeng Sun, Qing Yin, Xianyong Liu, Xun Suo, Wei Wang
    PLOS ONE.2015; 10(3): e0121647.     CrossRef
  • From the Macro to the Micro: Gel Mapping to Differentiate between Sporozoites of Two Immunologically Distinct Strains of Eimeria maxima (Strains M6 and Guelph)
    Saeed El-Ashram, Qing Yin, Hongbin Liu, Ibrahim Al Nasr, Xianyong Liu, Xun Suo, John Barta, Paulo Lee Ho
    PLOS ONE.2015; 10(12): e0143232.     CrossRef
  • Identification of differentially expressed proteins in sulfadiazine resistant and sensitive strains of Toxoplasma gondii using difference-gel electrophoresis (DIGE)
    Christelle Doliwa, Dong Xia, Sandie Escotte-Binet, Emma L. Newsham, Sanderson Sanya J., Dominique Aubert, Nadine Randle, Jonathan M. Wastling, Isabelle Villena
    International Journal for Parasitology: Drugs and Drug Resistance.2013; 3: 35.     CrossRef
  • Proteome expression changes among virulent and attenuated Neospora caninum isolates
    Javier Regidor-Cerrillo, Gema Álvarez-García, Iván Pastor-Fernández, Virginia Marugán-Hernández, Mercedes Gómez-Bautista, Luis M. Ortega-Mora
    Journal of Proteomics.2012; 75(8): 2306.     CrossRef
  • Modulation of mouse macrophage proteome induced by Toxoplasma gondii tachyzoites in vivo
    D. H. Zhou, Z. G. Yuan, F. R. Zhao, H. L. Li, Y. Zhou, R. Q. Lin, F. C. Zou, H. Q. Song, M. J. Xu, X. Q. Zhu
    Parasitology Research.2011; 109(6): 1637.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Proteomic Analysis of Toxoplasma gondii KI-1 Tachyzoites
Korean J Parasitol. 2010;48(3):195-201.   Published online September 16, 2010
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Proteomic Analysis of Toxoplasma gondii KI-1 Tachyzoites
Korean J Parasitol. 2010;48(3):195-201.   Published online September 16, 2010
Close

Figure

  • 0
  • 1
Proteomic Analysis of Toxoplasma gondii KI-1 Tachyzoites
Image Image
Fig. 1 Separation of total proteins extracted from T. gondii RH (A) and KI-1 (B) tachyzoites by 2-DE. KI-1, isolated from the blood of an ocular patient in Korea; RH, virulent strain of T. gondii. The proteins were focused to their isoelectric points using 17-cm ReadyStrip™ IPG pH 3-10 non-linear gradient strips. Each panel is representative of 3 independent experiments.
Fig. 2 Protein spots identified by 2-DE showing a higher than 5-fold difference in density between KI-1 and RH gels were analyzed by MALDI-TOF mass spectrometry. In the KI-1 gel, identification numbers (ID#) 2, 3, 4, 7, and 8 were analyzed, while in the RH gel, ID# 3, 5, 6, 7, 8, 9, and 10 were analyzed. Each panel is representative of 3 independent experiments.
Proteomic Analysis of Toxoplasma gondii KI-1 Tachyzoites
Protein Primer sequence Product size (bp) GRA2 Forward AGAGGCAACAAGAGCCAGAA 200 Reverse TTCTTTGGCCACCTTGAAAC GRA3 Forward GGAAGATGATCAGGCTCTCG 197 Reverse GATGGTCGCTCTCTCCAGTC GRA6 Forward GGGCACAAGACGACGTTATT 203 Reverse TATTGCCTGCATCATTTCCA GRA7 Forward GTGCCGGAACTAACAGAGGA 200 Reverse GATTCAGGCACCTCTTGCTC HGXPRTasea Forward GGTAAATGTCCCGTCGAGAA 197 Reverse GGAGTTGGGTCGAGAGAACA UPRTaseb Forward CAGGACAGGCACACTCGTTA 203 Reverse TGCTTCCTTCTCGTTCATCA LDHc Forward ATTGCTGACACGAACGTGAG 199 Reverse CAAGCGGGCAGTACTTCTTC Chorismate synthase Forward GGCTTGGAACAAGAAACTGC 201 Reverse GCAACCACTGTGTTGAGGAA DHFR-TSd Forward GCACACGTCTGCAACCTAAA 197 Reverse TAGCCCACGACCTCAAAATC SAG1 Forward TGTCAAGTTGTCTGCGGAAG 197 Reverse TGGCACCATTATCACTCGAA Actin Forward AGGATCTGTACGGCAACGTC 201 Reverse TGATCCACATCTGCTGGAAG NTPasee-I Forward GAGTGGACGCTGACACTGAA 192 Reverse GGTCAATGCTACGGCCTTTA NTPase-II Forward TTGCCATTTTGGACTCACAG 205 Reverse CGTGTCCAGAAAGGATTGGT Hexokinase Forward CTGATGGATAGGTCCGGAGA 193 Reverse CAAGCAACACTGCCACATCT Peroximal catalase Forward CTCATATGGTGCCAGGGATT 200 Reverse CAGCTGAGACCCTTTGTTCC GAPDH Forward CCAAGCACGCCATTATTTCT 207 Reverse TCGCTGCATGTACGGTAGTC Spot No. pH Molecular weight (kDa) Type of tachyzoite 34 5.8 74 RH 35 6.0 74 RH 47 5.7 65 RH 48 5.9 65 RH 79 5.8 48 RH 80 5.8 48 RH 81 5.9 48 RH 104 5.8 36 RH 105 6.9 36 RH 134 8.7 26 KI-1 138 8.7 26 KI-1 140 4.2 26 KI-1 144 4.7 24 KI-1 148 6.0 23 KI-1 ID Protein MW Da/pI Masses matched (Sequence covered; %) Protein name KI-1 #2 25858/5.1 5 (30) GRA7 precursor 24030/5.5 3 (23) GRA6 26386/5.9 1 (5) HGXPRTase KI-1 #3 25858/5.1 16 (4.2) GRA7 precursor KI-1 #4 25858/5.1 3 (15) GRA7 precursor 27647/6.6 2 (9) UPRTase 24030/5.5 3 (13) GRA6 26386/5.9 2 (8) HGXPRTase 23644/4.5 1 (4) GRA3 precursor KI-1 #7 19843/9.0 2 (15) GRA2 precursor KI-1 #8 19843/9.0 1 (4) GRA2 precursor ID Protein MW Da/pI Masses matched (Sequence covered; %) Protein name RH #3 34829/8.3 1 (7) SAG1 precursor 35307/6.5 1 (7) LDH RH #5 41908/5.0 1 (3) Actin RH #6 41908/5.0 2 (5) Actin 35307/6.5 1 (5) LDH RH #7 58145/7.9 2 (4) Chorismate synthase 57271/6.7 1 (2) Peroxisomal catalase RH #8 51468/5.9 1 (1) Hexokinase 57271/6.7 2 (4) Peroxisomal catalase 58145/7.9 2 (3) Chorismate synthase RH #9 68752/6.8 2 (3) DHFR-TS 58145/7.9 2 (5) Chorismate synthase 51468/5.9 1 (2) Hexokinase 69586/5.7 2 (5) NTPase-II precursor 65763/6.5 3 (7) Putative NTPase 69160/6.0 1 (3) NTPase-I precursor RH #10 58145/7.9 4 (5) Chorismate synthase 51468/5.9 2 (4) Hexokinase 65763/6.5 2 (2) Putative NTPase 68752/6.8 1 (1) DHFR-TS 69160/6.0 1 (1) NTPase-I precursor 69586/5.7 1 (1) NTPase-II precursor Protein CT valuea
P-value KI-1 RH Fold-difference (KI-1/RH) GRA2 0.741 ± 0.028 0.683 ± 0.003 1.085 0.024448 GRA3 1.123 ± 0.019 0.941 ± 0.015 1.193 0.000209 GRA6 0.954 ± 0.009 0.823 ± 0.023 1.159 0.000758 GRA7 0.815 ± 0.023 0.889 ± 0.039 0.917 0.04912 SAG1 0.721 ± 0.015 0.781 ± 0.017 0.923 0.010799 NTPaseI 0.826 ± 0.005 0.898 ± 0.044 0.920 0.047986 NTPaseII 0.769 ± 0.016 0.844 ± 0.034 0.911 0.026487 UPRTase 1.697 ± 0.0141 1.499 ± 0.030 1.132 0.000489 Chorismate synthase 1.143 ± 0.056 1.134 ± 0.0441 1.008 0.009063
Table 1. Primer sequences for quantitative real time PCR

Hypoxanthine-guanine-xanthine phosphoribosyltransferase;

Uracil phosphoribosyltransferase;

L-lactate dehydrogenase;

Bifunctional dihydrofolate reductase-thymidylate synthase;

Nucleoside-triphosphatase.

Table 2. Protein spots identified by 2-DE showing a higher than 5-fold difference in density between KI-1 and RH gels

Data are representative of 3 independent experiments.

Table 3. Identification of KI-1 tachyzoites protein spots showing more than 5 times density difference in 2-DE analysis between KI-1 and RH gels

Identifications of proteins were used peptide mass fingerprint data from MALDI-TOF mass spectrometry, and searched full gene sequence data. Data are representative of 3 independent experiments.

Table 4. Identification of RH strain protein spots showing more than 5 times density difference in 2-DE analysis between KI-1 and RH gels

Identifications of proteins were used peptide mass fingerprint data from MALDI-TOF mass spectrometry, and searched full gene sequence data. Data are representative of 3 independent experiments.

Table 5. Real time PCR of proteins showed different expression in MALDI-TOF analysis

Mean ± SD of cycle threshold values (target/GAPDH).

Data are representative of 3 independent experiments.