Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection

The Korean Journal of Parasitology 2011;49(3):235-243.
Published online: September 30, 2011

1Department of Parasitology, School of Medicine, Pusan National University, Yangsan 626-870, Korea.

2Department of Internal Medicine, School of Medicine, Pusan National University, Yangsan 626-870, Korea.

3Department of Mcirobiology & Immunology, School of Medicine, Pusan National University, Yangsan 626-870, Korea.

4Department of Nursing, College of Nursing, Pusan National University, Yangsan 626-870, Korea.

Corresponding author (hsyu@pusan.ac.kr)

Mi Kyung Park and Min Kyoung Cho equally contributed to this study.

• Received: April 25, 2011   • Revised: June 20, 2011   • Accepted: June 21, 2011

© 2011, Korean Society for Parasitology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,405 Views
  • 86 Download
  • 24 Crossref
  • 25 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Gestodene Accelerates Cutaneous Wound Healing via PAR1-Selective Positive Allosteric Modulation
    Hyejin Jeon, Yunkyung Heo, Yechan Lee, So-Hyeon Park, Mincheol Kang, Wan Namkung
    International Journal of Molecular Sciences.2026; 27(12): 5502.     CrossRef
  • Innate Immune Recognition of Helminths: TLRs and Beyond
    Camila de Almeida Lopes, Linda Djune Yemeli, Pedro Gazzinelli‐Guimaraes
    Parasite Immunology.2025;[Epub]     CrossRef
  • A novel trypsin of Trichinella spiralis mediates larval invasion of gut epithelium via binding to PAR2 and activating ERK1/2 pathway
    Lu Lu Han, Qi Qi Lu, Wen Wen Zheng, Yang Li Li, Yan Yan Song, Xin Zhuo Zhang, Shao Rong Long, Ruo Dan Liu, Zhong Quan Wang, Jing Cui, Krystyna Cwiklinski
    PLOS Neglected Tropical Diseases.2024; 18(1): e0011874.     CrossRef
  • Pathogenesis ofBrucellaepididymoorchitis-game ofBrucelladeath
    Jiuwang Yu, Sha Li, Lu Wang, Zhiheng Dong, Lengge Si, Lidao Bao, Lan Wu
    Critical Reviews in Microbiology.2022; 48(1): 96.     CrossRef
  • Cytokines and beyond: Regulation of innate immune responses during helminth infection
    Oyebola O. Oyesola, Simon P. Früh, Lauren M. Webb, Elia D. Tait Wojno
    Cytokine.2020; 133: 154527.     CrossRef
  • Animal Models for Functional Gastrointestinal Disorders
    Alison Accarie, Tim Vanuytsel
    Frontiers in Psychiatry.2020;[Epub]     CrossRef
  • Adoptive transfer of Trichinella spiralis-activated macrophages can ameliorate both Th1- and Th2-activated inflammation in murine models
    Shin Ae Kang, Mi-Kyung Park, Sang Kyun Park, Jun Ho Choi, Da In Lee, So Myong Song, Hak Sun Yu
    Scientific Reports.2019;[Epub]     CrossRef
  • The role of rare innate immune cells in Type 2 immune activation against parasitic helminths
    LAUREN M. WEBB, ELIA D. TAIT WOJNO
    Parasitology.2017; 144(10): 1288.     CrossRef
  • The induction of the collagen capsule synthesis by Trichinella spiralis is closely related to protease-activated receptor 2
    Mi Kyung Park, Min Kyoung Cho, Shin Ae Kang, Bo Young Kim, Hak Sun Yu
    Veterinary Parasitology.2016; 230: 56.     CrossRef
  • Human Helminths and Allergic Disease: The Hygiene Hypothesis and Beyond
    Thomas B. Nutman, Helton C. Santiago
    The American Journal of Tropical Medicine and Hygiene.2016; 95(4): 746.     CrossRef
  • The role of infection in the pathogenesis of allergodermatoses
    E. V. Svirshchevskaya, E. V. Matushevskaya, D. B. Chudakov, Yu. I. Matushevskaya
    Klinicheskaya dermatologiya i venerologiya.2015; 14(2): 4.     CrossRef
  • Genetic regulation of immunoglobulin E level in different pathological states: integration of mouse and human genetics
    Elena S. Gusareva, Iryna Kurey, Igor Grekov, Marie Lipoldová
    Biological Reviews.2014; 89(2): 375.     CrossRef
  • Thymic stromal lymphopoietin and atopic diseases
    J.M. Leyva-Castillo, M. Li
    Revue Française d'Allergologie.2014; 54(5): 364.     CrossRef
  • Parasitic Nematode-Induced CD4+Foxp3+T Cells Can Ameliorate Allergic Airway Inflammation
    Shin Ae Kang, Mi-Kyung Park, Min Kyoung Cho, Sang Kyun Park, Min Seong Jang, Bo-Gie Yang, Myoung Ho Jang, Dong-Hee Kim, Hak Sun Yu, Edward Mitre
    PLoS Neglected Tropical Diseases.2014; 8(12): e3410.     CrossRef
  • Coinfection with Clonorchis sinensis modulates murine host response against Trichinella spiralis infection
    Ying Chen, Bo Huang, Shiguang Huang, Xinbing Yu, Yonglong Li, Wenjian Song, Yongxiang Li, Fangli Lu
    Parasitology Research.2013; 112(9): 3167.     CrossRef
  • Alteration of Cytokine Production during Visceral Larva Migrans by Toxascaris leonina in Mice
    Shin Ae Kang, Mi-Kyung Park, Min Kyoung Cho, Hak Sun Yu
    The Korean Journal of Parasitology.2013; 51(5): 583.     CrossRef
  • Toward Drugs for Protease-Activated Receptor 2 (PAR2)
    Mei-Kwan Yau, Ligong Liu, David P. Fairlie
    Journal of Medicinal Chemistry.2013; 56(19): 7477.     CrossRef
  • IL-32-PAR2 axis is an innate immunity sensor providing alternative signaling for LPS-TRIF axis
    Masanori Nakayama, Yasuo Niki, Toshiki Kawasaki, Yuki Takeda, Hiroyasu Ikegami, Yoshiaki Toyama, Takeshi Miyamoto
    Scientific Reports.2013;[Epub]     CrossRef
  • Protease‐activated receptor‐2 signalling by tissue factor on dendritic cells suppresses antigen‐specific CD4+ T‐cell priming
    Seema Shrivastava, Liang Ma, El‐Li Tham, John H. McVey, Daxin Chen, Anthony Dorling
    Immunology.2013; 139(2): 219.     CrossRef
  • Molecular characterization of 45kDa aspartic protease of Trichinella spiralis
    Jong Nam Park, Sang Kyun Park, Min Kyoung Cho, Mi-Kyung Park, Shin Ae Kang, Dong-Hee Kim, Hak Sun Yu
    Veterinary Parasitology.2012; 190(3-4): 510.     CrossRef
  • Regulation and dysregulation of innate immunity by NFAT signaling downstream of pattern recognition receptors (PRRs)
    Ivan Zanoni, Francesca Granucci
    European Journal of Immunology.2012; 42(8): 1924.     CrossRef
  • TSLP Expression: Cellular Sources, Triggers, and Regulatory Mechanisms
    Toshiro Takai
    Allergology International.2012; 61(1): 3.     CrossRef
  • Regulation of epithelial immunity by IL-17 family cytokines
    Rajita Pappu, Sascha Rutz, Wenjun Ouyang
    Trends in Immunology.2012; 33(7): 343.     CrossRef
  • Regulation of type 2 immunity to helminths by mast cells
    Matthew R. Hepworth, Marcus Maurer, Susanne Hartmann
    Gut Microbes.2012; 3(5): 476.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection
Korean J Parasitol. 2011;49(3):235-243.   Published online September 30, 2011
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection
Korean J Parasitol. 2011;49(3):235-243.   Published online September 30, 2011
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection
Image Image Image Image Image Image
Fig. 1 Comparison of spleen enlargement by T. spiralis infection between PAR2 KO mice and WT mice. The length of spleens was calculated by a ruler (A). The number of splenocytes was calculated using a hemocytometer after spleen cell isolation (B). inf(+), T. spiralis-infected; inf(-), T. spiralis-uninfected (**P<0.01).
Fig. 2 Cytokines production of splenocytes in PAR2 KO and WT mice. inf(+), T. spiralis-infected; inf(-), T. spiralis-uninfected; Non, non-stimulation; CD3+, anti-CD3 antibody stimulation (*P<0.05, **P<0.01).
Fig. 3 Cytokines production of MLN lymphocytes in PAR2 KO and WT mice. inf(+), T. spiralis-infected; inf(-), T. spiralis-uninfected; Non, non-stimulation; CD3+, anti-CD3 stimulation (*P<0.05, **P<0.01).
Fig. 4 Comparison of total immunoglobulins and anti-T. spiralis-specific immunoglobulins level between PAR2 KO and WT mice (*P<0.05, ***P<0.001).
Fig. 5 Evaluation of protease activity of T. spiralis excretory-secretory proteins. Protease activity of ES protein (A). M, molecular marker; Lane 1, ES protein of T. spiralis; Lane 2, boiled ES protein; Lane 3, PMSF pre-treated ES protein; Lane 4, leupeptin pre-treated ES protein.
Fig. 6 Th2 chemokine gene expression of CT-26 cells after T. spiralis excretory-secretory protein treatment. ES, T. spiralis ES protein; ES+PMSF, PMSF pre-treated ES protein; ES+Leupeptin, leupeptin pre-treated ES protein (*P<0.05, **P<0.01, ***P<0.001).
Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection
Primer Sequence GAPDH-for* 5´ - TACCCCCAATGTGTCCGTC - 3´ GAPDH-rev 5´ - AAGAGTGGGAGTTGCTGTTGAAG - 3´ Eotaxin-for 5´ - GCGCTTCTATTCCTGCTGCTCACGG - 3´ Eotaxin-rev 5´ - GTGGCATCCTGGACCCACTTCTTC - 3´ TSLP-for 5´ - GGAGATTTGAAAGGGGCTAAG - 3´ TSLP-rev 5´ - TGGGCAGTGGTCATTGAG - 3´ IL-25-for 5´ - TGGCAATGATCGTGGGAACC - 3´ IL-25-rev 5´ - GAGAGATGGCCCTGCTGTTGA - 3´
Table 1. Primers used for real-time PCR

for, forward;

rev, reverse.