Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Prevalence of Drug Resistance-Associated Gene Mutations in Plasmodium vivax in Central China

The Korean Journal of Parasitology 2012;50(4):379-384.
Published online: November 26, 2012

1Department of Medical Environmental Biology and Tropical Medicine, Kangwon National University School of Medicine, Chuncheon 200-701, Korea.

2Jiangsu Institute of Parasitic Diseases, Key Laboratory on Technology for Parasitic Disease Prevention and Control, Ministry of Health, Wuxi, Jiangsu, China.

3Mahidol Vivax Research Center, Faculty of Tropical Medicine, Mahidol University, Bangkok 10400, Thailand.

4Department of Internal Medicine, Gachon University Cheolwon Gil Hospital, Cheolwon 269-800, Korea.

Corresponding author (ethan@kangwon.ac.kr; gaoqi54@hotmail.com)

These authors contributed equally to this study.

• Received: July 29, 2012   • Revised: October 11, 2012   • Accepted: October 12, 2012

© 2012, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,966 Views
  • 98 Download
  • 35 Crossref
  • 40 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Chloroquine-resistant Plasmodium vivax malaria in Ethiopia: A systematic review and meta-analysis
    Yenesew Mihret Wondmagegn, Abebaw Setegn, Getu Girmay, Muluneh Assefa, Banchayehu Getnet, Tena Cherkos, Wagaw Abebe, Nega Dessie, Adane Derso, Zufan Yiheyis, Adane Adugna, Tadesse Misganaw, Aberham Abere, Mebratu Tamir, Mekuriaw Belayneh, Azanaw Amare, Ag
    Acta Tropica.2026; 273: 107947.     CrossRef
  • Genetic Diversity of Potential Drug Resistance Markers in Plasmodium vivax Isolates from Panama, Mesoamerica
    Vanessa Vásquez, Ana María Santamaría, Dianik Moreno, Fergie Ruíz, Chystrie A. Rigg, Luis F. Chaves, José E. Calzada
    Pathogens.2025; 14(3): 231.     CrossRef
  • Are pvcrt-o and pvmdr1 Gene Mutations Associated with Plasmodium vivax Chloroquine-Resistant Parasites?
    Rebecca de Abreu-Fernandes, Natália Ketrin Almeida-de-Oliveira, Aline Rosa de Lavigne Mello, Lucas Tavares de Queiroz, Jacqueline de Aguiar Barros, Bárbara de Oliveira Baptista, Joseli Oliveira-Ferreira, Rodrigo Medeiros de Souza, Lilian Rose Pratt-Riccio
    Biomedicines.2024; 12(1): 141.     CrossRef
  • Polymorphisms of potential drug resistant molecular markers in Plasmodium vivax from China–Myanmar border during 2008‒2017
    Zhensheng Wang, Chunyan Wei, Yunchun Pan, Zhihua Wang, Xin Ji, Qianqian Chen, Lianhui Zhang, Zenglei Wang, Heng Wang
    Infectious Diseases of Poverty.2022;[Epub]     CrossRef
  • Prevalence of pvmrp1 Polymorphisms and Its Contribution to Antimalarial Response
    Yi Yin, Gangcheng Chen, Myat Htut Nyunt, Meihua Zhang, Yaobao Liu, Guoding Zhu, Xinlong He, Fang Tian, Jun Cao, Eun-taek Han, Feng Lu
    Microorganisms.2022; 10(8): 1482.     CrossRef
  • Assessing the in vitro sensitivity with associated drug resistance polymorphisms in Plasmodium vivax clinical isolates from Delhi, India
    Monika Matlani, Amit Kumar, Vineeta Singh
    Experimental Parasitology.2021; 220: 108047.     CrossRef
  • Monitoring Plasmodium vivax resistance to antimalarials: Persisting challenges and future directions
    Marcelo U. Ferreira, Tais Nobrega de Sousa, Gabriel W. Rangel, Igor C. Johansen, Rodrigo M. Corder, Simone Ladeia-Andrade, José Pedro Gil
    International Journal for Parasitology: Drugs and Drug Resistance.2021; 15: 9.     CrossRef
  • Phylogenetic analysis suggests single and multiple origins of dihydrofolate reductase mutations in Plasmodium vivax
    Ayaz Shaukat, Qasim Ali, Lucy Raud, Abdul Wahab, Taj Ali Khan, Imran Rashid, Muhammad Rashid, Mubashir Hussain, Mushtaq A. Saleem, Neil D. Sargison, Umer Chaudhry
    Acta Tropica.2021; 215: 105821.     CrossRef
  • Antimalarial Drug Resistance and Implications for the WHO Global Technical Strategy
    Matthew M. Ippolito, Kara A. Moser, Jean-Bertin Bukasa Kabuya, Clark Cunningham, Jonathan J. Juliano
    Current Epidemiology Reports.2021; 8(2): 46.     CrossRef
  • Polymorphism of Antifolate Drug Resistance in Plasmodium vivax From Local Residents and Migrant Workers Returned From the China-Myanmar Border
    Weilin Zeng, Siqi Wang, Shi Feng, Daibin Zhong, Yue Hu, Yao Bai, Yonghua Ruan, Yu Si, Hui Zhao, Qi Yang, Xinxin Li, Xi Chen, Yanmei Zhang, Cuiying Li, Zheng Xiang, Yanrui Wu, Fang Chen, Pincan Su, Benjamin M. Rosenthal, Zhaoqing Yang
    Frontiers in Cellular and Infection Microbiology.2021;[Epub]     CrossRef
  • Molecular Surveillance and Ex Vivo Drug Susceptibilities of Plasmodium vivax Isolates From the China–Myanmar Border
    Weilin Zeng, Hui Zhao, Wei Zhao, Qi Yang, Xinxin Li, Xiaosong Li, Mengxi Duan, Xun Wang, Cuiying Li, Zheng Xiang, Xi Chen, Liwang Cui, Zhaoqing Yang
    Frontiers in Cellular and Infection Microbiology.2021;[Epub]     CrossRef
  • Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018
    Chaturong Noisang, Wieland Meyer, Nongyao Sawangjaroen, John Ellis, Rogan Lee
    Pathogens.2020; 9(2): 101.     CrossRef
  • Plasmodium vivax drug resistance markers: Genetic polymorphisms and mutation patterns in isolates from Malaysia
    Fei-Wen Cheong, Shairah Dzul, Mun-Yik Fong, Yee-Ling Lau, Sasheela Ponnampalavanar
    Acta Tropica.2020; 206: 105454.     CrossRef
  • Ex vivo susceptibilities of Plasmodium vivax isolates from the China-Myanmar border to antimalarial drugs and association with polymorphisms in Pvmdr1 and Pvcrt-o genes
    Jiangyan Li, Jie Zhang, Qian Li, Yue Hu, Yonghua Ruan, Zhiyong Tao, Hui Xia, Jichen Qiao, Lingwen Meng, Weilin Zeng, Cuiying Li, Xi He, Luyi Zhao, Faiza A. Siddiqui, Jun Miao, Zhaoqing Yang, Qiang Fang, Liwang Cui, Kamala Thriemer
    PLOS Neglected Tropical Diseases.2020; 14(6): e0008255.     CrossRef
  • An unlabelled probe-based real time PCR and modified semi-nested PCR as molecular tools for analysis of chloroquine resistant Plasmodium vivax isolates from Afghanistan
    Sayed Hussain Mosawi, Abdolhossein Dalimi, Najibullah Safi, Reza Fotouhi-Ardakani, Fatemeh Ghaffarifar, Javid Sadraei
    Malaria Journal.2020;[Epub]     CrossRef
  • Molecular surveillance for drug resistance markers in Plasmodium vivax isolates from symptomatic and asymptomatic infections at the China–Myanmar border
    Yan Zhao, Lin Wang, Myat Thu Soe, Pyae Linn Aung, Haichao Wei, Ziling Liu, Tongyu Ma, Yuanyuan Huang, Lynette J. Menezes, Qinghui Wang, Myat Phone Kyaw, Myat Htut Nyunt, Liwang Cui, Yaming Cao
    Malaria Journal.2020;[Epub]     CrossRef
  • Selective sweep and phylogenetic models for the emergence and spread of pyrimethamine resistance mutations in Plasmodium vivax
    Ayaz Shaukat, Qasim Ali, Timothy Connelley, Muhammad Azmat Ullah Khan, Mushtaq A. Saleem, Mike Evans, Imran Rashid, Neil D. Sargison, Umer Chaudhry
    Infection, Genetics and Evolution.2019; 68: 221.     CrossRef
  • Polymorphisms in genes associated with drug resistance of Plasmodium vivax in India
    Vamsi Mohan Anantabotla, Hiasindh Ashmi Antony, Subhash Chandra Parija, Nonika Rajkumari, Jyoti R. Kini, Radhakrishna Manipura, Vijaya Lakshmi Nag, R. Gadepalli, Nirupama Chayani, Somi Patro
    Parasitology International.2019; 70: 92.     CrossRef
  • Molecular detection of drug resistant malaria in Southern Thailand
    Chaturong Noisang, Christiane Prosser, Wieland Meyer, Waenurama Chemoh, John Ellis, Nongyao Sawangjaroen, Rogan Lee
    Malaria Journal.2019;[Epub]     CrossRef
  • Drug resistance genes: pvcrt-o and pvmdr-1 polymorphism in patients from malaria endemic South Western Coastal Region of India
    Shiny Joy, Benudhar Mukhi, Susanta K. Ghosh, Rajeshwara N. Achur, D. Channe Gowda, Namita Surolia
    Malaria Journal.2018;[Epub]     CrossRef
  • Presence of novel triple mutations in the pvdhfr from Plasmodium vivax in Mangaluru city area in the southwestern coastal region of India
    Shiny Joy, Susanta K. Ghosh, Rajeshwara N. Achur, D. Channe Gowda, Namita Surolia
    Malaria Journal.2018;[Epub]     CrossRef
  • The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Kritpaphat Tantiamornkul, Tepanata Pumpaibool, Jittima Piriyapongsa, Richard Culleton, Usa Lek-Uthai
    International Journal for Parasitology: Drugs and Drug Resistance.2018; 8(2): 229.     CrossRef
  • Simultaneous detection of Plasmodium vivax dhfr, dhps, mdr1 and crt-o resistance-associated mutations in the Colombian Amazonian region
    Juan Ricardo Cubides, Paola Andrea Camargo-Ayala, Carlos Hernando Niño, Diego Garzón-Ospina, Anggie Ortega-Ortegón, Estefany Ospina-Cantillo, María Fernanda Orduz-Durán, Manuel Elkin Patarroyo, Manuel Alfonso Patarroyo
    Malaria Journal.2018;[Epub]     CrossRef
  • Molecular Evidence of Drug Resistance in Asymptomatic Malaria Infections, Myanmar, 2015
    Myat Htut Nyunt, Thinzar Shein, Ni Ni Zaw, Soe Soe Han, Fauzi Muh, Seong-Kyun Lee, Jin-Hee Han, Kyaw Zin Thant, Eun-Taek Han, Myat Phone Kyaw
    Emerging Infectious Diseases.2017; 23(3): 517.     CrossRef
  • Clinical and molecular surveillance of drug resistant vivax malaria in Myanmar (2009–2016)
    Myat Htut Nyunt, Jin-Hee Han, Bo Wang, Khin Myo Aye, Kyin Hla Aye, Seong-Kyun Lee, Ye Htut, Myat Phone Kyaw, Kay Thwe Han, Eun-Taek Han
    Malaria Journal.2017;[Epub]     CrossRef
  • Low prevalence of dihydro folate reductase (dhfr) and dihydropteroate synthase (dhps) quadruple and quintuple mutant alleles associated with SP resistance in Plasmodium vivax isolates of West Bengal, India
    Sabyasachi Das, Abhijit Banik, Amiya Kumar Hati, Somenath Roy
    Malaria Journal.2016;[Epub]     CrossRef
  • Polymorphisms in chloroquine resistance-associated genes in Plasmodium vivax in Ethiopia
    Lemu Golassa, Berhanu Erko, Frederick N Baliraine, Abraham Aseffa, Göte Swedberg
    Malaria Journal.2015;[Epub]     CrossRef
  • Amplification of pfmdr1 , pfcrt , pvmdr1 , and K13 Propeller Polymorphisms Associated with Plasmodium falciparum and Plasmodium vivax Isolates from the China-Myanmar Bord
    Jun Feng, Daili Zhou, Yingxue Lin, Huihui Xiao, He Yan, Zhigui Xia
    Antimicrobial Agents and Chemotherapy.2015; 59(5): 2554.     CrossRef
  • Molecular surveillance of pvdhfr, pvdhps, and pvmdr-1 mutations in Plasmodium vivax isolates from Yunnan and Anhui provinces of China
    Bo Huang, Shiguang Huang, Xin-zhuan Su, Xinxin Tong, Junping Yan, Hongbin Li, Fangli Lu
    Malaria Journal.2014;[Epub]     CrossRef
  • Prevalence and patterns of antifolate and chloroquine drug resistance markers in Plasmodium vivax across Pakistan
    Aamer A Khattak, Meera Venkatesan, Lubna Khatoon, Amed Ouattara, Leo J Kenefic, Muhammad F Nadeem, Farida Nighat, Salman A Malik, Christopher V Plowe
    Malaria Journal.2013;[Epub]     CrossRef
  • N-TerminalPlasmodium vivaxMerozoite Surface Protein-1, a Potential Subunit for Malaria Vivax Vaccine
    Fernanda G. Versiani, Maria E. Almeida, Luis A. Mariuba, Patricia P. Orlandi, Paulo A. Nogueira
    Clinical and Developmental Immunology.2013; 2013: 1.     CrossRef
  • In vitro chloroquine resistance for Plasmodium vivax isolates from the Western Brazilian Amazon
    Yonne F Chehuan, Monica RF Costa, Jacqueline S Costa, Maria GC Alecrim, Fátima Nogueira, Henrique Silveira, Larissa W Brasil, Gisely C Melo, Wuelton M Monteiro, Marcus VG Lacerda
    Malaria Journal.2013;[Epub]     CrossRef
  • High levels of IgG3 anti ICB2-5 in Plasmodium vivax-infected individuals who did not develop symptoms
    Fernanda G Versiani, Maria EM Almeida, Gisely C Melo, Francivaldo OL Versiani, Patrícia P Orlandi, Luís André M Mariúba, Leidiane A Soares, Luciana P Souza, Antonio A da Silva Balieiro, Wuelton M Monteiro, Fabio TM Costa, Hernando A del Portillo, Marcus V
    Malaria Journal.2013;[Epub]     CrossRef
  • Prevalence of drug resistance associated mutations in Plasmodium vivax against sulphadoxine-pyrimethamine in southern Pakistan
    Afsheen Raza, Najia K Ghanchi, Muhammad Shahzeb Khan, Mohammad Asim Beg
    Malaria Journal.2013;[Epub]     CrossRef
  • Blood Stage of Plasmodium vivax in Central China Is Still Susceptible to Chloroquine Plus Primaquine Combination Therapy
    Eun-Taek Han, Yaobao Liu, Feng Lu, Qi Gao, Jun Cao, Guoding Zhu, Huayun Zhou
    The American Journal of Tropical Medicine and Hygiene.2013; 89(1): 184.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Prevalence of Drug Resistance-Associated Gene Mutations in Plasmodium vivax in Central China
Korean J Parasitol. 2012;50(4):379-384.   Published online November 26, 2012
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Prevalence of Drug Resistance-Associated Gene Mutations in Plasmodium vivax in Central China
Korean J Parasitol. 2012;50(4):379-384.   Published online November 26, 2012
Close

Figure

  • 0
Prevalence of Drug Resistance-Associated Gene Mutations in Plasmodium vivax in Central China
Image
Fig. 1 Schematic diagrams of amino acid point mutation positions and sequencing regions of pvmdr1 (A), pvcrt-o (B), pvdhfr (C), and pvdhps (D) genes. Previously reported point mutations are indicated, and resistance-conferring mutations are marked in red. B and D; boxes indicate exons, and lines indicate introns. R; repeat region GGDN/TSGGDN/THGGDN (C) and GEAKLTN-GEGKLTN-GEAKLTN-GEGKLTN-GEAKLTN-GEGKLTN-GDAKLTN-GDSKLTN-GEAKLTN (D).
Prevalence of Drug Resistance-Associated Gene Mutations in Plasmodium vivax in Central China
Gene Primer sequence (5´→3´) Position (bp)a Use Amplicon size (bp) Annealing temp. (°C) Reference Pvmdr1 F: GGATAGTCATGCCCCAGGATTG 2751--2772 PCR/Seq 604 62 [9] R: CATCAACTTCCCGGCGTAGC 3335--3354 PCR Pvcrt-o F: AAGAGCCGTCTAGCCATCC −99--−81 PCR/Seq 1,186 61 [35] R: AGTTTCCCTCTACACCCG 1069--1086 PCR Pvdhfr F: ATGGAGGACCTTTCAGATGTATT 1--23 PCR/Seq 716 58 [11] R:CCACCTTGCTGTAAACCAAAAAGTCCAGAG 686--715 PCR Pvdhps F1:AGGAAGCCATTCGCTCAAC 1121--1139 PCR 1,700 56 [34] R1:GGAACGCTGCAAACAACAC +211--+229 PCR F2:GGTTTATTTGTCGATCCTGTG 1300--1320 PCR/Seq 1,301 56 [14] R2:GAGATTACCCTAAGGTTGATGTATC 2576--+9 PCR/Seq Genotype in each drug resistant gene No. of isolates sequenced/no. of total isolate selected (%) Pvmdr1  Wild-type Y976 codon 26/26 (100)  Mutant L1076 codon 26/26 (100) Pvcrt-o  Wild-type without K10 insert 22/22 (100) Pvdhfr  Wild-type genotype (IPCNFSTVSIA) 8/26 (30.8)  Mutant N117 codon 18/26 (69.2)  Mutant tandem repeata 20/26 (76.9) Pvdhps  Wild-type genotype (SACKAVA) 23/23 (100)  Mutant tandem repeatb 23/23 (100)
Table 1. Sequence and features of primers used in this study

The position of the primer is given according to the nucleotide sequence of the target gene. Primers anchored outside the open reading frame were marked as–(extended at 5´ end) and + (3´ end). Seq, sequencing; F, forward primer; R, reverse primer.

Table 2. Prevalence of single nucleotide polymorphisms and tandem repeat genotypes in pvmdr1, pvcrt-o, pvdhfr, and pvdhps genes in central China

Including 2 types; deletion of 292-309 base pairs (65.4%, 17/26) and mutation at codon 99 (11.5%, 3/26).

Including 2 types with the sequences of GEAKLTN-GEGKLTN-GEAKLTN- GEGKLTN-GDAKLTN-GDSKLTN-GDSKLT-GEAKLTN (4.3%, 1/23) and GEAKLTN-GEGKLTN-GEGKLTN-GEAKLTN-GEGKLTN- GDAKLTN- GDSKLTN-GEAKLTN (95.7%, 22/23).