Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Acanthamoeba

The Korean Journal of Parasitology 2013;51(3):269-277.
Published online: June 30, 2013

1Department of Parasitology and Tropical Medicine, Kyungpook National University School of Medicine, Daegu 700-422, Korea.

2National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Obihiro 080-8555, Japan.

3Department of Ophthalmology, Kyungpook National University Hospital, Daegu 700-721, Korea.

4Department of Parasitology, Dong-A University, College of Medicine, Busan 602-714, Korea.

Corresponding author (ychong@knu.ac.kr)

These authors contributed equally to this work.

• Received: April 19, 2013   • Revised: May 18, 2013   • Accepted: May 20, 2013

© 2013, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12,219 Views
  • 96 Download
  • 9 Crossref
  • 17 Scopus
next

Citations

Citations to this article as recorded by  Crossref logo
  • Ultrasensitive and rapid diagnostic tool for detection of Acanthamoeba castellanii
    Susanna Haapanen, Maarit S. Patrikainen, Seppo Parkkila
    Diagnostic Microbiology and Infectious Disease.2023; 107(2): 116014.     CrossRef
  • A simple and visible detection method for the rapid diagnosis of Ustilaginoidea virens in rice seeds by a loop‐mediated isothermal amplification assay
    Wei Wang, Hang Yin, Ning Huang, Cuijing Zhu, Yufei Wang, Xintong Qi, Lu Ma, Yunxin Fan, Yao Yu, Hongsheng Zhang, Yongmei Bao
    Journal of Phytopathology.2021; 169(6): 369.     CrossRef
  • Efficient nested-PCR-based method development for detection and genotype identification of Acanthamoeba from a small volume of aquatic environmental sample
    Tsui-Kang Hsu, Jung-Sheng Chen, Hsin-Chi Tsai, Chi-Wei Tao, Yu-Yin Yang, Ying-Chin Tseng, Yi-Jie Kuo, Dar-Der Ji, Jagat Rathod, Bing-Mu Hsu
    Scientific Reports.2021;[Epub]     CrossRef
  • Development of Visually Improved Loop Mediated Isothermal Amplification for the Diagnosis of Plasmodium vivax Malaria in a Tertiary Hospital in Chandigarh, North India
    Hargobinder Kaur, Rakesh Sehgal, Devendra Bansal, Ali A. Sultan, Ashish Bhalla, Sunit C. Singhi
    The American Journal of Tropical Medicine and Hygiene.2018; 98(5): 1374.     CrossRef
  • Detection of Acanthamoeba spp. in water samples collected from natural water reservoirs, sewages, and pharmaceutical factory drains using LAMP and PCR in China
    Anna Lass, Milena Guerrero, Xiuping Li, Gabriele Karanis, Liqing Ma, Panagiotis Karanis
    Science of The Total Environment.2017; 584-585: 489.     CrossRef
  • Water-borne protozoa parasites: The Latin American perspective
    Félix Manuel Rosado-García, Milena Guerrero-Flórez, Gabriele Karanis, María Del Carmen Hinojosa, Panagiotis Karanis
    International Journal of Hygiene and Environmental Health.2017; 220(5): 783.     CrossRef
  • Evaluation of Loop-mediated Isothermal Amplification Assay for Rapid Diagnosis of Acanthamoeba Keratitis
    Abhishek Mewara, Sumeeta Khurana, Shakila Yoonus, Kirti Megha, Parveen Tanwar, Amit Gupta, Rakesh Sehgal
    Indian Journal of Medical Microbiology.2017; 35(1): 90.     CrossRef
  • Acanthamoeba keratitis: improving the Scottish diagnostic service for the rapid molecular detection of Acanthamoeba species
    Claire Low Alexander, Michael Coyne, Brian Jones, Deepa Anijeet
    Journal of Medical Microbiology .2015; 64(7): 682.     CrossRef
  • Molecular diagnosis in clinical parasitology: When and why?
    Samson SY Wong, Kitty SC Fung, Sandy Chau, Rosana WS Poon, Sally CY Wong, Kwok-Yung Yuen
    Experimental Biology and Medicine.2014; 239(11): 1443.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Acanthamoeba
Korean J Parasitol. 2013;51(3):269-277.   Published online June 30, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Acanthamoeba
Korean J Parasitol. 2013;51(3):269-277.   Published online June 30, 2013
Close

Figure

  • 0
  • 1
  • 2
Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Acanthamoeba
Image Image Image
Fig. 1 Nucleotide sequence alignments of target regions in the Acanthamoeba 18S rDNA genes of the 11 tested Acanthamoeba species. Primer recognition sites are indicated by arrows and gray boxes with primer names. Black boxes indicate non-conserved nucleotides. The black arrowhead indicates the NcoI cleavage site. F3, forward outer primer; B3, backward outer primer; FIP, forward inner primer; BIP, backward inner primer; LF, loop forward primer; and LB, loop backward primer.
Fig. 2 Sensitivities and specificities of Acanthamoeba LAMP assays. LAMP assays were performed using serial dilutions of (A) plasmid DNA containing Acanthamoeba castellanii 18S rDNA (10, 102, 103, or 104 copies per reaction) and (B) genomic DNA (100, 10, or 1 pg). Plasmid containing no insert was used as a control. LAMP products were visualized by (C) gel electrophoresis and using (D) the Loopamp® fluorescent detection reagent (FD). Lanes M1 and M2, 1-kb and 100-bp molecular weight markers, respectively; lane 1, Acanthamoeba astronyxis; lane 2, Acanthamoeba triangularis; lane 3, Acanthamoeba rhysodes; lane 4, Acanthamoeba castellanii; lane 5, Acanthamoeba lugdunensis; lane 6, Acanthamoeba polyphaga; lane 7, Acanthamoeba quina; lane 8, Acanthamoeba griffini; lane 9, Acanthamoeba hatchetti; lane 10, Acanthamoeba culbertsoni; lane 11, Acanthamoeba healyi; lane 12, Aspergillus fumigatus; lane 13, Fusarium solani; lane 14, Candida albicans; lane 15, Entamoeba histolytica; lane 16, Giardia lamblia; lane 17, Escherichia coli; lane 18, distilled water; and lane 18, NcoI digestion of the LAMP product of 18S rDNA.
Fig. 3 Detection of Acanthamoeba in heat-treated ocular clinical samples by LAMP and PCR; (A and B) Electrophoresis of PCR (A) and LAMP assay products (B) amplified from heat-treated ocular clinical samples from a patient with suspected keratitis. (A) Lanes 1-2, heat-treated lysates of contact lens solutions from left and right lens case chambers, respectively; lane 3, heat treated lysate of corneal scrapings; lane P, 1 pg of A. castellanii genomic DNA (positive control); lane N, negative control (distilled water); lane M, 100-bp ladder DNA marker. (B) Lane 1, heat-treated lysate of contact lens solutions from the right lens case chamber; lane 3, heat-treated lysate of corneal scrapings; lane 5, 1 pg of A. castellanii genomic DNA (positive control); lanes 2, 4, and 6; NcoI digestions of the LAMP products of lanes 1, 3, and 5, respectively. (C) Real-time turbidity LAMP assay of the sample in (B). CLS, contact lens solution; CS, corneal scraping; PC, positive control; DW, distilled water. (D) Photographs of trophozoites of Acanthamoeba sp. detected by cultures of corneal scrapings and a contact lens solution of the same samples mentioned in (B) (original magnification×400, scale bar=10 µm).
Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Acanthamoeba
Species Genotype Strain ATCC No. Source Geographic source Acanthamoeba griffini T3 S-7 30731 Beach-bottom United States Acanthamoeba triangularis T4 SH621 50254 Human feces France Acanthamoeba rhysodes T4 Singh 30973 Soil England Acanthamoeba castellanii T4 Castellani 30011 Yeast culture England Acanthamoeba lugdunensis T4 L3a 50240 Swimming pool France Acanthamoeba polypaga T4 Page23 30871 Freshwater United States Acanthamoeba quina T4 Vil3 50241 Swimming pool France Acanthamoeba astronyxis T7 Ray & Hayes 30137 Soil United States Acanthamoeba culbertsoni T10 Lilly A-1 30171 Tissue culture United States Acanthamoeba hatchetti T11 BH-2 30730 Ocean sediment United States Acanthamoeba healyi T12 OC-3A 30866 GAEa United States Target gene Primer Sequence (5´→3´) 18S rDNA F3 GGCGACGATTCATTCAAAT B3 CAAGACTCTTGTCGAGCGC FIP TCCCTCTCCGGAATCGAACCCTCGATGGTAGGATAGAGGCC BIP TTCTAAGGAAGGCAGCAGGCGTATTGTCACTACCTCCCCGT LF TCCGTTACCCGTTACGACCA LB CGCAAATTACCCAATCCCGAC Assay No. of samples with the following culture detection methods (%)
Commercial kit
Heat treated/NaOH
Corneal scrapings (n = 11) Contact lens sdutions (n = 4) Corneal scrapings (n = 11) Contact lens sdutions (n=4) 18S rDNA PCR  Nelson primers 9 (81.8) 4 (100.0) 0 0  JDP primers 8 (72.7) 4 (100.0) 0 0 18S rDNA LAMP 11 (100) 4 (100.0) 11 (100.0) 4 (100.0)
Table 1. List of Acanthamoeba reference species used in the LAMP assay
Table 2. The sequences of the LAMP primer sets used to amplify Acanthamoeba 18S rDNA genes for the LAMP assay
Table 3. Detection of Acanthamoeba by the conventional PCR and LAMP assay using 2 differently prepared samples