Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Genetic Characterization of Clinical Acanthamoeba Isolates from Japan using Nuclear and Mitochondrial Small Subunit Ribosomal RNA

The Korean Journal of Parasitology 2013;51(4):401-411.
Published online: August 30, 2013

1Department of Parasitology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Ishikawa, Japan.

2Department of Parasitology, National Institute of Infectious Diseases, Toyama, Shinjuku-ku, Tokyo, Japan.

3Department of Ophthalmology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Ishikawa, Japan.

4Department of Medical Zoology, Kanazawa Medical University, Kanazawa, Ishikawa, Japan.

5Department of Medical Laboratory Sciences, Faculty of Medicine and Health Sciences, An-Najah National University, Nablus, West-Bank, Palestine.

Corresponding author (tokoro@med.kanazawa-u.ac.jp)
• Received: May 2, 2013   • Revised: June 17, 2013   • Accepted: June 18, 2013

© 2013, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12,489 Views
  • 116 Download
  • 17 Crossref
  • 18 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • A novel rapid detection approach based on CRISPR-Cas13a for Dermatophagoides pteronyssinus and Dermatophagoides farinae (Acariformes: Pyroglyphidae)
    Siwen Liu, Lan Wang, Hong Zhang, Feng Jiang, Feifan Tang, Renren Han, Wei Guo, Shengli Gu, Guoqing Chen, Dacun Zhang, Xiaodong Zhan, Xiao-Qiang Yu
    Journal of Insect Science.2026;[Epub]     CrossRef
  • Molecular Evidence for Greater Diversity Within Acanthamoeba
    Daniele Corsaro
    Acta Parasitologica.2025;[Epub]     CrossRef
  • Molecular Typing of Acanthamoeba Using Mitochondrial rDNA Spacers
    Daniele Corsaro
    Microorganisms.2025; 13(10): 2285.     CrossRef
  • Sub-Genotyping of Acanthamoeba T4 Complex: Experience from North India
    Kirti Megha, Megha Sharma, Amit Gupta, Rakesh Sehgal, Sumeeta Khurana
    Parasitologia.2023; 3(1): 69.     CrossRef
  • Molecular evidence for a new lineage within the Acanthamoeba T4 genotype
    Daniele Corsaro, Danielle Venditti
    Parasitology Research.2023; 122(6): 1445.     CrossRef
  • Identification and genotyping of Acanthamoeba spp. in the water resources of western Iran
    Azadeh Karimi, Farnaz Kheirandish, Amirreza Javadi Mamaghani, Niloofar Taghipour, Syedeh Fatemeh Mousavi, Ali Aghajani, Nozhat Zebardast, Majid Faraji, Shirzad Fallahi
    Parasite Epidemiology and Control.2023; 22: e00308.     CrossRef
  • The Risk Factors and Clinical Features of Acanthamoeba Keratitis: First Time Detection of Acanthamoeba T5 Genotype from Keratitis Patients in Turkey
    Derya Dirim Erdogan, Mehmet Aykur, Nur Selvi Gunel, Melis Palamar, Ozlem Barut Selver, Buket Ozel, Ayse Yagci, Cumhur Gunduz, Hande Dagci
    Acta Parasitologica.2022; 67(3): 1384.     CrossRef
  • Exploring LSU and ITS rDNA Sequences for Acanthamoeba Identification and Phylogeny
    Daniele Corsaro
    Microorganisms.2022; 10(9): 1776.     CrossRef
  • Genotype distribution of Acanthamoeba in keratitis: a systematic review
    Maria Luisa Nunes Diehl, Júlia Paes, Marilise Brittes Rott
    Parasitology Research.2021; 120(9): 3051.     CrossRef
  • Molecular identification and phylogenetic analysis of free-living amoeba (Naegleria and Acanthamoeba) from treated and untreated drinking water
    Omid Ahmadi, Yousef Sharifi, Nazgol Khosravinia, Elham Moghaddas, Mohammad Akhoundi, Reza Fotouhi-Ardakani, Jaber Asadi, Amir Hossein Mohamadzade, Ghodratolah Salehi Sangani, Hamed Mirjalali, Mehdi Zarean
    Gene Reports.2021; 25: 101328.     CrossRef
  • Isolates from ancient permafrost help to elucidate species boundaries in Acanthamoeba castellanii complex (Amoebozoa: Discosea)
    Stas Malavin, Lyubov Shmakova
    European Journal of Protistology.2020; 73: 125671.     CrossRef
  • Update on Acanthamoeba phylogeny
    Daniele Corsaro
    Parasitology Research.2020; 119(10): 3327.     CrossRef
  • Lower prevalence of Entamoeba species in children with vertically transmitted HIV infection in Western Kenya
    Elizabeth Jemaiyo Matey, Masaharu Tokoro, Takehiro Nagamoto, Tetsushi Mizuno, Matilda Chelimo Saina, Xiuqiong Bi, Jane A. Oyombra, Paul Okumu, Benard Kibet Langat, Willie Kipkemboi Sang, Elijah Maritim Songok, Hiroshi Ichimura
    AIDS.2016; 30(5): 803.     CrossRef
  • Positive correlation of HIV infection with Giardia intestinalis assemblage B but not with assemblage A in asymptomatic Kenyan children
    Elizabeth J. Matey, Masaharu Tokoro, Tetsushi Mizuno, Takahiro Matsumura, Takehiro Nagamoto, Xiuqiong Bi, Jane A. Oyombra, Willie K. Sang, Elijah M. Songok, Hiroshi Ichimura
    AIDS.2016; 30(15): 2385.     CrossRef
  • Isolation and Genotyping of Acanthamoeba spp. as Neglected Parasites in North of Iran
    Azar Shokri, Shahabeddin Sarvi, Ahmad Daryani, Mehdi Sharif
    The Korean Journal of Parasitology.2016; 54(4): 447.     CrossRef
  • Presence of potential pathogenic genotypes of free-living amoebae isolated from sandboxes in children's playgrounds
    Marcin Cholewinski, Piotr Solarczyk, Monika Derda, Agnieszka Wojtkowiak-Giera, Edward Hadas
    Folia Parasitologica.2015;[Epub]     CrossRef
  • Morphological Features andIn VitroCytopathic Effect ofAcanthamoeba griffiniTrophozoites Isolated from a Clinical Case
    Arturo González-Robles, Lizbeth Salazar-Villatoro, Maritza Omaña-Molina, Maria Reyes-Batlle, Carmen M. Martín-Navarro, Jacob Lorenzo-Morales
    Journal of Parasitology Research.2014; 2014: 1.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genetic Characterization of Clinical Acanthamoeba Isolates from Japan using Nuclear and Mitochondrial Small Subunit Ribosomal RNA
Korean J Parasitol. 2013;51(4):401-411.   Published online August 30, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genetic Characterization of Clinical Acanthamoeba Isolates from Japan using Nuclear and Mitochondrial Small Subunit Ribosomal RNA
Korean J Parasitol. 2013;51(4):401-411.   Published online August 30, 2013
Close

Figure

  • 0
  • 1
  • 2
Genetic Characterization of Clinical Acanthamoeba Isolates from Japan using Nuclear and Mitochondrial Small Subunit Ribosomal RNA
Image Image Image
Fig. 1 Representative image of culture-isolated Acanthamoeba sp. from an AK case (JPH9). Nomarski interference contrast micrograph of cysts showing double-layered walls and a trophozoite showing spike-like pseudopodia (acanthopodia). Scale bar=10 µm.
Fig. 2 Neighbor-joining (NJ) tree reconstructed with the 18S rDNA sequences of Acanthamoeba. The evolutionary history was inferred using the NJ method as described in "Materials and Methods". Isolates from Acanthamoeba keratitis are shown in boldface text, mixed infections with underlines, and with new or reference accession numbers. All reference sequences are shown with the accession numbers and the genotypes. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap value (1,000 replicates) are shown next to the branches. The evolutionary distances are shown in the units of the number of base substitutions per site.
Fig. 3 NJ tree reconstructed with the 16S rDNA sequences of Acanthamoeba. Isolates from Acanthamoeba keratitis are shown in boldface text, mixed infections with underlining, and with new or reference accession numbers. All reference sequences are shown with the accession numbers and the genotypes. Representative NJ tree with bootstrap value (1,000 replicates) for NJ, MP, and ML methods, conducted as described in "Materials and Methods", are shown. The analysis involved 55 nucleotide sequences. An asterisk indicates a value of less than 50% or if a position of the node is differ according to each analysis method. The evolutionary distances are shown in the units of the number of base substitutions per site.
Genetic Characterization of Clinical Acanthamoeba Isolates from Japan using Nuclear and Mitochondrial Small Subunit Ribosomal RNA
Primer ID Sequences (5´ to 3´) and locations on genesa Product size (bp) For 18S rRNA gene  YKF2 1CCTCCTTCTGGATTCCCGTTC21 560  JDP2 560TCTCACAAGCTGCTAGGGGAGTCA537 For 16S rRNA gene  FP16 1TTGTATAAACAATCGTTGGGTTTTATT27 1533  RP16 1533GTCCAGCAGCAGGTTCCCCTACCGCTA1507 Sample name Target loci for genotyping
18S rRNA gene 16S rRNA gene JPH1 T4 (U07415) T4 (AF479533) JPH2 T4 (GU936484) T4 (AB795705) JPH3 T4 (U07403) T4 (AF479533) JPH4 T4 (U07413) T4 (AF479533) JPH5A* T4 (U07408) T4 (AB795706) JPH5B* T4 (AY173000) T4 (AB795706) JPH6 T3 (S81337) T3 (AB795707) JPH7 T5 (AB741044) T5 (AB795708) JPH8 T4 (AB741046) T4 (AF479533) JPH9 T4 (U07415) T4 (AF479533) JPH10 T4 (U07410) T4 (AB795709) JPH11 T4 (GU808328) T4 (AF479524) JPH12 T4 (U07403) T4 (AF479533) JPH13 T4 (AB741047) T4 (AF479534) JPH14 T4 (GU936484) T4 (AB795710) JPH15 T4 (U07403) T4 (AF479533) JPH16 T4 (U07410) T4 (AF479534) JPH17Aa T4 (U07415) T4 (AB795711) JPH17Ba T4 (U07403) T4 (AB795711) JPH18 T4 (AB795719) T4 (AB795712) JPH19 T4 (U07408) T4 (AB795713) JPH20 T4 (U07403) T4 (AF479533) JPH21 T4 (U07410) T4 (AF479534) JPH22 T4 (AY173000) T4 (AB795714) JPH23 T3 (GQ397466) T3 (AB795715) JPH24 T4 (AB741045) T4 (AB795716) JPH25 T3 (GQ905499) T3 (AB795717) JPH26 T4 (AY703004) T4 (AF479533) JPH27 T4 (AY148954) T4 (AB795718)
Nucleotide positionsa 890 891 902 893 894 900 901 906 908 1295 1319 1320 1324 1325 1326 1327 1344
JPH5A T G C G G C A C T C C A C G G T
JPH5B A T G C G T C
Nucleotide positionsa 874 888 889 894 895 897 909 1283 1302 1303 1304 1305 1312 1313 1314 1315 1318 1325
JPH17A A A T C T T T C G G C C G G T A
JPH17B G G T A C G C C G G T C G G C C C G
Isolate name Accession No. Genotype Isolation/place of origin Reference V006 U07400 T1 GAE, Brain, Georgia, USA [32] Reich U07411 T2 Soil, Israel [32] H37 S81337 T3 Keratitis, UK [37] S-7 U07412 T3 Shallow beach, New London, CT, USA [32] AcaVN04 GQ397466 T3 Air conditioner scrape, Slovakia [38] AcaVNAK05 GQ905499 T3 Keratitis, Slovakia [38] V042 U07403 T4 Keratitis, Illinois, USA [32] Castellani U07413 T4 Yeast culture, London, UK [32] Neff U07416 T4 Soil, USA [32] JAC/S2 U07415 T4 Soil, Japan [32] U/Oft1 AY026248 T4 Brazil Direct submission M3 GU936484 T4 Cooling towers water, France [39] 82-12-324 U07408 T4 Keratitis, Houston, TX, USA [32] KA/MSS8-1 AY173000 T4 Marine sediment, Korea Direct submission 88-2-37 U07410 T4 Keratitis, Houston, TX, USA [32] KA/MSG15 AY173007 T4 Marine sediment, Korea Direct submission V390 AY703004 T4 Skin, Atlanta, GA, USA [40] KA/E5 AY148954 T4 Keratitis, Korea Direct submission Ac_PCN18c GU808328 T4 Keratitis, Thailand [18] 407-3a U94734 T5 Acid waste dump, Atlantic Ocean, USA [13] 25/1 U94740 T5 Nasal mucosa, Germany [13] 2802 AF019063 T6 Swimming pool, France [13] Ray & Hayes AF019064 T7 Lab water, Washington, USA [13] OC-15C AF019065 T8 Freshwater, Maryland, USA [13] Comandon & de Fonbrune AF019066 T9 Soil, France [13] Lilly A-1 AF019067 T10 Human cell culture, Indiana, USA [13] BH-2 AF019068 T11 Brackish water, Maryland, USA [13] V013 AF019070 T12 GAE, brain, Barbados, BWI [13] UWC9 AF132134 T13 Keratitis, MN, USA [41] PN15 AF333607 T14 Human cell culture, Pakistan [42] AC005 AY262360 T15 Marine source, USA [43] JPH7 AB741044 T5 Keratitis, Kanazawa, Japan This study JPH8 AB741046 T4 Keratitis, Kanazawa, Japan This study JPH13 AB741047 T4 Keratitis, Kanazawa, Japan This study JPH18 AB795719 T4 Keratitis, Kanazawa, Japan This study JPH24 AB741045 T4 Keratitis, Kanazawa, Japan This study Isolate name Accession No. Genotype Isolation/Place of origin Reference CDC V006 AF479547 T1 GAE, Brain, Georgia, USA [21] Reich AF479563 T2 Soil, Israel [21] Panola Mtn. AF479535 T3 Soil, Georgia, USA [21] S-7 AF479562 T3 Beach bottom, Connecticut, USA [21] Ma AF479533 T4 Keratitis, New York, USA [21] JAC E2 AF479497 T4 Keratitis, Japan [21] Neff AF479560 T4 Soil, California, USA [21] CDC V014 AF479550 T4 Keratitis, India [21] AA2 EU515178 T4 Soil, Morocco [44] 1652 EU515180 T4 Soil, Mauritania [21] SAWL 93/1 AF479512 T4 Keratitis, South Africa [21] AA1 EU515179 T4 Soil, France [44] CCAP, 1501-3D AF479537 T4 Keratitis, UK [21] CDC V029 AF479526 T4 Keratitis, Massachusetts, USA [21] CEI 73-01-16 AF479557 T4 Keratitis, Texas, USA [21] CEI 85-6116 AF479553 T4 Keratitis, Texas, USA [21] Singh EU515177 T4 Soil, UK [21] Oak Ridge AF479559 T4 Human tissue culture [21] SH621 EU515183 T4 Human feces, France Direct submission CEI 88-2-27 AF479558 T4 Keratitis, Texas, USA [21] CDC V125 AF479524 T4 Keratitis, California, USA [21] CDC V383 AF479534 T4 Keratitis, Argentina [21] CDC V168 AF479525 T4 Skin infection, USA [21] KA/E9 EU515181 T4 Keratitis, Korea Direct submission KA/E17 EU572722 T4 Keratitis, Korea Direct submission KA/E23 EU515182 T4 Keratitis, Korea Direct submission LVPEI 402/97 AF479506 T4 Keratitis, India [21] LVPEI 773/96 AF479507 T4 Keratitis, India [21] LVPEI 1035/99 AF479508 T4 Keratitis, India [21] LVPEI 98/00 AF479509 T4 Keratitis, India [21] LVPEI 1060/96 AF479549 T4 Keratitis, India [21] LVPEI 1002/99 AF479551 T4 Keratitis, India [21] LVPEI 749/98 AF479552 T4 Keratitis, India [21] SAWS 87/1 AF479538 T5 Sewage sludge, South Africa [21] PD2S AF479541 T5 Swimming pool, France [21] Ray & Hayes AF479546 T7 Lab water, Washington, USA [21] NMFS OC-15C AF479545 T8 Freshwater, Maryland, USA [21] AIP AF479544 T9 Soil, France [21] CDC 409 AF479542 T10 Horse brain, USA [21] OHSU M001 AF479536 T11 Keratitis, Oregon, USA [21] CDC V013 AF479548 T12 GAE, brain, British West Indies [21] JPH2 AB795705 T4 Keratitis, Kanazawa, Japan This study JPH5 AB795706 T4 Keratitis, Kanazawa, Japan This study JPH6 AB795707 T3 Keratitis, Kanazawa, Japan This study JPH7 AB795708 T5 Keratitis, Kanazawa, Japan This study JPH10 AB795709 T4 Keratitis, Kanazawa, Japan This study JPH14 AB795710 T4 Keratitis, Kanazawa, Japan This study JPH17 AB795711 T4 Keratitis, Kanazawa, Japan This study JPH18 AB795712 T4 Keratitis, Kanazawa, Japan This study JPH19 AB795713 T4 Keratitis, Kanazawa, Japan This study JPH22 AB795714 T4 Keratitis, Kanazawa, Japan This study JPH23 AB795715 T3 Keratitis, Kanazawa, Japan This study JPH24 AB795716 T4 Keratitis, Kanazawa, Japan This study JPH25 AB795717 T3 Keratitis, Kanazawa, Japan This study JPH27 AB795718 T4 Keratitis, Kanazawa, Japan This study
Table 1. Primers used in this study

Base pair positions are according to A. castellanii Neff strain on 18S rRNA gene (U07416) [35] and on 16S rRNA gene (AF479560) [36].

Table 2. Comparison of genotyping results assessed in this study

Mixed haplotype profiles of T4 sub-genotypes observed in 18S rRNA gene were analyzed using the subcloning procedure described in “Materials and Methods”. JPH5 and JPH17 samples, which were consisted of 2 sub-genotypes: JPH5 (JPH5A and JPH5B) and JPH17 (JPH17A and JPH17B).

(A) JPH5

Nucleotide positions are shown according to the reference sequence (U07408). Sequence heterogeneities were observed in JPH5, and the subcloning procedure could confirm 2 sub-genotypes, JPH5A (U07408) and JPH5B (AY173000). Only the substituted nucleotides are shown with position numbers. Hyphen indicates an insertion/deletion mutation.

(B) JPH17

Nucleotide positions are shown according to the reference sequence (U07415). Sequence heterogeneities were observed in JPH17, and the subcloning procedure could confirm 2 sub-genotypes, JPH17A (U07415) and JPH17B (U07403). Only the substituted nucleotides are shown with position numbers. Hyphen indicates an insertion/deletion mutation.

Table 4. 18S rRNA gene sequences used in this study
Table 5. 16S rRNA gene sequence used in this study