Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Development of Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Azumiobodo hoyamushi (Kinetoplastea)

The Korean Journal of Parasitology 2014;52(3):305-310.
Published online: June 26, 2014

1Department of Parasitology and Tropical Medicine, Kyungpook National University School of Medicine, Daegu 700-422, Korea.

2Aquaculture Management Division, National Fisheries Research & Development Institute, Busan 619-705, Korea.

3Department of Parasitology, School of Medicine, Pusan National University, Yangsan 626-870, Korea.

4Department of Life Science and Biotechnology, College of Natural Sciences, Soonchunhyang University, Asan 336-745, Korea.

5National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Obihiro 080-8555, Japan.

6Department of Preventive Medicine, Kyungpook National University School of Medicine, Daegu 700-422, Korea.

Corresponding author (ychong@knu.ac.kr)

These authors contributed equally to this work.

• Received: February 28, 2014   • Revised: April 3, 2014   • Accepted: April 4, 2014

© 2014, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,514 Views
  • 92 Download
  • 3 Web of Science
  • 2 Crossref
  • 2 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Nucleic Acid Nanotechnology‐Empowered CRISPR‐Cas12a Systems for Biosensing and Bioimaging Applications
    Qian Hou, Jinghan Ren, Yuzhen Wu, Peiran Zhao, Shuzhen Yue, Sai Bi
    Small Methods.2026;[Epub]     CrossRef
  • Measurement of Tunic Hardness in an Edible Ascidian, Halocynthia roretzi, with Remarks on Soft Tunic Syndrome
    Euichi Hirose, Kei Nakayama, Tetsuya Yanagida, Akatsuki Nawata, Shin-Ichi Kitamura
    Zoological Science.2018; 35(6): 548.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development of Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Azumiobodo hoyamushi (Kinetoplastea)
Korean J Parasitol. 2014;52(3):305-310.   Published online June 26, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development of Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Azumiobodo hoyamushi (Kinetoplastea)
Korean J Parasitol. 2014;52(3):305-310.   Published online June 26, 2014
Close

Figure

  • 0
  • 1
Development of Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Azumiobodo hoyamushi (Kinetoplastea)
Image Image
Fig. 1 Detection limit of Azumiobodo hoyamushi 18S rDNA LAMP assays (A). LAMP assays were performed using serial dilutions of A. hoyamushi genomic DNA (1 ng to 1 fg per reaction). Distilled water was used as a negative control. LAMP products were visualized by gel electrophoresis (B) and using Loopamp® fluorescent detection reagent (FD) (C). (B, C) Lane M, 100-bp DNA marker; lane 1, 1 ng; lane 2, 100 pg; lane 3, 10 pg; lane 4, 1 pg; lane 5, 100 fg; lane 6, 10 fg; lane 7, 1 fg of A. hoyamushi genomic DNA; lane 8, distilled water; and lane 9, LAMP product after MboI digestion. (D-E) A. hoyamushi at a density of 1×103 parasites/µl was serially diluted and tested (D) using the LAMP assay (D) and by PCR (E) using F3 and B3 primers. Lane M, 100-bp DNA marker; lane 1, 1,000; lane 2, 100; lane 3, 10; lane 4, 1; lane 5, 0.1; lane 6, 0.01 of parasites per reaction; lane 7, distilled water. A. hoyamushi genomic DNA was prepared using DNeasy tissue kits (Qiagen) from in vitro cultured A. hoyamushi species [9] which were kindly provided by Dr. Kyung Il Park (Kunsan National University, Gunsan, Korea).
Fig. 2 Results of the LAMP assay for detection of Azumiobodo hoyamushi from AsSTS (Grades 2, 3) and non-diseased (Grade 1) ascidians. (A) The amplified products of LAMP reactions were examined by real-time turbidity: A. hoyamushi genomic DNA (1 pg), non-diseased ascidian DNA (100 ng), AsSTS ascidian DNA (Grade 3, 100 ng; Grade 2, 100 ng; [please confirm here] Grade 2, 10 ng), and distilled water. (B-C) Detection of A. hoyamushi in non-diseased (Grade 1) and in AsSTS infected ascidians (Grades 2, 3) using DNAs (B) prepared by a commercial kit (DNeasy tissue kit, Qiagen) or heat-treated lysates (C).
Development of Loop-Mediated Isothermal Amplification Targeting 18S Ribosomal DNA for Rapid Detection of Azumiobodo hoyamushi (Kinetoplastea)
Primer Sequence (5´-3´) F3 GAATGGTGGTGCATGGCC B3 GCCCAAAATCTCACCTCGTT FIP (F1c-F2) CTACTGGGCGGCTTGGATCTCGCTTTTGGTCGGTGGAGT BIP (B1c-B2) AGCAATCCTCTTGCTCGGCTTAGGAATCCCGCAGAGAAGG LF GTTGACGGAATCAACCAAACAAATC LB CGGCTGACTGAGGCAACCT Assay Microscopy PCR LAMP AsSTS-suspected ascidians (n = 36) Positive: 27 Positive: 27 Positive: 27 Negative: 9 Positive: 5 Positive: 5 Negative: 4 Positive: 1 Negative: 3 Non-diseased ascidians (n = 50) Positive: 0 Positive: 1 Positive: 3 Negative: 50 Negative: 49 Negative: 47  Sensitivity (%) (95% CI) 79.4 (61.6-90.7) 100 (87.4-100)  Specificity (%) (95% CI) 100 (91.6-100) 94.3 (83.4-98.5)   PPV (%) (95% CI) 100 (84.5-100) 91.9 (77.0-97.9)   NPV (%) (95% CI) 88.3 (76.8-94.8) 100 (91.1-100)   Kappaa (95% CI) 0.825 (0.702-0.947) 0.926 (0.850-1.000)
Table 1. Names and sequences of the primers used for A. hoyamushi 18S rDNA LAMP reaction

F3, forward outer primer; B3, backward outer primer; FIP, forward inner primer; BIP, backward inner primer; LF, loop forward primer; and LB, loop backward primer.

Table 2. Sensitivity, specificity, PPV, NPV, and agreements of microscopy and LAMP versus PCR (the gold standard)

CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value.

κ values range from a minimum of 0 (complete disagreement) to 1 (perfect agreement), and κ values of 0.9 to 1.0 are generally accepted to mean excellent agreement.