Warning: fopen(/home/virtual/parasitol/journal/upload/ip_log/ip_log_2025-12.txt): failed to open stream: Permission denied in /home/virtual/lib/view_data.php on line 83

Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 84
Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR
Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR

The Korean Journal of Parasitology 2014;52(6):645-652.
Published online: December 23, 2014

1Rural Development Administration, Suwon 441-707, Korea.

2Department of Infection Biology, Chungnam National University School of Medicine, Daejeon 301-131, Korea.

3Department of Gastroenterology, The Affiliated Hospital of Guangdong Medical College, Zhanjiang 524-001, Guangdong, China.

4Department of Medical Environmental Biology, College of Medicine, Chung-Ang University, Seoul 156-756, Korea.

Corresponding author (yhalee@cnu.ac.kr)

Hwang-Yong Kim and In-Wook Choi contributed equally to this work.

• Received: September 9, 2014   • Revised: November 20, 2014   • Accepted: November 21, 2014

© 2014, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,816 Views
  • 139 Download
  • 9 Web of Science
  • 8 Crossref
  • 10 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Distribution and Fasciola infection rates of Lymnaea snails and cattle in high-salinity areas of Mekong Delta, Vietnam
    Dang Thi LOAN, Lam Thanh NGUYEN, Tran Ngoc BICH, Nguyen Thuy Y VI, Yasunobu MATSUMOTO
    Journal of Veterinary Medical Science.2025; 87(3): 291.     CrossRef
  • Susceptibility of lymnaeid snails to Fasciola hepatica and Fasciola gigantica (Digenea: Fasciolidae): a systematic review and meta-analysis
    Philile Ignecious Ngcamphalala, Ignore Nyagura, Mokgadi Pulane Malatji, Samson Mukaratirwa
    PeerJ.2025; 13: e18976.     CrossRef
  • Green vegetable juice as a potential source of human fascioliasis in Korea
    Sungim Choi, Sunghee Park, Sooji Hong, Hyejoo Shin, Bong-Kwang Jung, Min Jae Kim
    One Health.2022; 15: 100441.     CrossRef
  • Snail-borne parasitic diseases: an update on global epidemiological distribution, transmission interruption and control methods
    Xiao-Ting Lu, Qiu-Yun Gu, Yanin Limpanont, Lan-Gui Song, Zhong-Dao Wu, Kamolnetr Okanurak, Zhi-Yue Lv
    Infectious Diseases of Poverty.2018;[Epub]     CrossRef
  • Morphological Characterization of Emerging Cercariae among Lymnaeid Snails from Barangay Cawongan, Padre Garcia, Batangas, Philippines
    Gregorio L. Martin I, Esperanza C. Cabrera
    Journal of Parasitology Research.2018; 2018: 1.     CrossRef
  • A Case of Fascioliasis in A Wild Nutria, Myocastor coypus, in Republic of Korea
    Hyo-Seok Kim, Joo-Yeon Kong, Jong-Hyun Kim, Seong-Chan Yeon, Il-Hwa Hong
    The Korean Journal of Parasitology.2018; 56(4): 375.     CrossRef
  • Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis
    In-Wook Choi, Hwang-Yong Kim, Juan-Hua Quan, Jae-Gee Ryu, Rubing Sun, Young-Ha Lee
    The Korean Journal of Parasitology.2015; 53(5): 641.     CrossRef
  • Ectopic Human <i>Fasciola hepatica</i> Infection by an Adult Worm in the Mesocolon
    Ah Jin Kim, Chang Hwan Choi, Sun Keun Choi, Yong Woon Shin, Yun-Kyu Park, Lucia Kim, Suk Jin Choi, Jee Young Han, Joon Mee Kim, Young Chae Chu, In Suh Park
    The Korean Journal of Parasitology.2015; 53(6): 725.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR
Korean J Parasitol. 2014;52(6):645-652.   Published online December 23, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR
Korean J Parasitol. 2014;52(6):645-652.   Published online December 23, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR
Image Image Image Image
Fig. 1 Locations of sites at which freshwater snails were collected. Dot (•); water-dropwort fields for snail collection.
Fig. 2 Agarose gel electrophoresis of PCR products containing internal transcribed spacer 1 (ITS-1) and ITS-2 markers of Fasciola hepatica. M, 100 bp marker; lanes 1-15, field snail samples; PC, positive control (F. hepatica worm). Upper panel, 433 bp for ITS-1; lower panel, 364 bp for ITS-2.
Fig. 3 Identification of snails collected from 4 large water-dropwort fields in Korea. (A) Sinistral (left-handed aperture) snails. (B) Dextral (right-handed aperture) snails. (C) Agarose gel electrophoresis of PCR products for detection of L. viridis, L. ollula, and L. auricularia from field snail samples. M, 100 bp marker; lanes 1-12, field snail samples.
Fig. 4 F. hepatica ITS-2 nucleotide sequences of 6 positive samples obtained from PCR products compared with a GenBank sequence (accession no. AJ272053.1). Base homologies are indicated by a dot (∙); base changes are shown in orange. The total length of the F. hepatica ITS-2 region is 468 bp.
Fasciola hepatica in Snails Collected from Water-Dropwort Fields using PCR
Target name Oligonucleotide sequence (5´-3´) Product size (bp) GenBank accession no.
Fasciola hepatica ITS-1 F: ATCATTACCTGAAAATCTACTCTCACA 433 AJ243016.1
R: GTACGTATGGTCAAAGACCAGGTT
Fasciola hepatica ITS-2 F: GTTATAAACTATCACGACGCCCAAA 364 AJ272053.1
R: GAAGACAGACCACGAAGGGTA
Lymnaea viridis 16S F: CGCAGTACCTTGACTGTGCT 208 AF485642.1
R: CGCCCCAACAAAAATAAGAG
Lymnaea ollula 28S F: GTAGCGATTCTGACGTGCAA 211 AY465065.1
R: AGCCGGACTTCTTACCCATT
Lymnaea auricularia ITS-1 F: GCACACGTCCTATCGAAACA 203 JX193589.1
R: AGAGCAAGGCCACTCTTTGA
Survey area Cheongdo Jeonju Suncheon Gijang Total
Items
No. of samples 52 71 43 183 349
Direction of aperture Sinistral Dextral Sinistral Dextral Sinistral Dextral Sinistral Dextral Sinistral Dextral
No. of snails (%) 21 (40.4) 31 (59.6) 14 (19.7) 57 (80.3) 36 (83.7) 7 (16.3) 65 (35.5) 118 (64.5) 136 (39.0) 213 (61.0)
Shell shape
 Shell height/width 8-12 (9.6 ± 1.3)/4-8 (5.8 ± 1.1) 6-11 (7.7 ± 1.4)/3-6 (3.8 ± 0.6) 6-9 (7.1 ± 1.4)/4-7 (4.6 ± 0.4) 5-8 (6.3 ± 1.6)/3-6 (3.9 ± 0.3) 7-12 (9.1 ± 1.2)/3-6 (3.7 ± 0.9) 7-11 (9.0 ± 1.1)/3-7 (3.3 ± 0.7) 7-16 (9.8 ± 1.8)/3-8 (6.3 ± 1.6) 7-13 (9.1 ± 1.9)/5-8 (6.1 ± 1.5) 5-16 (9.9 ± 1.4)/3-8 (5.5 ± 1.2) 5-13 (8.1 ± 1.5)/3-8 (4.1 ± 0.8)
 No. of whorls 4 4 4 4 4 4 4 4 4 4
 Aperture height/width 3-6 (5.5 ± 0.3)/3-4 (3.4 ± 0.2) 3-6 (4.3 ± 0.6)/2-4 (3.1 ± 0.5) 4-7 (4.2 ± 0.9)/2-4 (3.2 ± 0.8) 3-7 (3.8 ± 0.8)/2-4 (2.9 ± 0.7) 3-7 (5.8 ± 1.2)/2-4 (3.1 ± 0.4) 3-6 (5.2 ± 0.9)/2-4 (3.1 ± 0.4) 3-8 (5.3 ± 1.3)/3-6 (4.2 ± 0.9) 3-8 (5.2 ± 1.4)/2-8 (4.2 ± 0.9) 3-8 (5.7 ± 1.2)/2-6 (3.5 ± 0.7) 3-8 (4.4 ± 0.9)/2-6 (3.3 ± 0.6)
No. of F. hepatica-infected 0 0 0 11 0 0 0 1 0 12
No. of infected (%) 0 (0.0) 11 (15.5) 0 (0.0) 1 (0.5) 12 (3.4)
PCR result
 Reported vectors in Korea
  L. viridis - 0 - 1 1
  L. ollula - 5 - 0 5
  L. auricularia - 0 - 0 0
 The others - 6 - 0 6
Table 1. Primers used for detection of F. hepatica and identification of snail species collected from water-dropwort fields in Korea
Table 2. Morphological and molecular characteristics of the collected snails