Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Gene Cloning, Expression and Immunogenicity of the Protective Antigen Subolesin in Dermacentor silvarum

The Korean Journal of Parasitology 2014;52(1):93-97.
Published online: February 19, 2014

1Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University, Shijiazhuang, 050024, China.

2Shijiazhuang Post and Telecommunication Technical College, Shijiazhuang, 050021, China.

Corresponding author (jzliu21@heinfo.net)

Yonghong Hu and Hua Zeng contributed equally to this work.

• Received: July 3, 2013   • Revised: August 24, 2013   • Accepted: August 27, 2013

© 2014, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 9,440 Views
  • 95 Download
  • 3 Web of Science
  • 3 Crossref
  • 4 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Subolesin gene structure and mRNA isoform diversity in South African R. microplus ticks: Relevance for understanding subolesin-based tick vaccines
    Elsje Christine Rabie, Christine Maritz-Olivier
    Ticks and Tick-borne Diseases.2025; 16(4): 102502.     CrossRef
  • Transmission-Blocking Vaccines: Focus on Anti-Vector Vaccines against Tick-Borne Diseases
    Girish Neelakanta, Hameeda Sultana
    Archivum Immunologiae et Therapiae Experimentalis.2015; 63(3): 169.     CrossRef
  • Screening and Identification of Antigenic Proteins from the Hard Tick <i>Dermacentor silvarum</i> (Acari: Ixodidae)
    Tiantian Zhang, Xuejiao Cui, Jincheng Zhang, Hui Wang, Meng Wu, Hua Zeng, Yuanyuan Cao, Jingze Liu, Yonghong Hu
    The Korean Journal of Parasitology.2015; 53(6): 789.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Gene Cloning, Expression and Immunogenicity of the Protective Antigen Subolesin in Dermacentor silvarum
Korean J Parasitol. 2014;52(1):93-97.   Published online February 19, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Gene Cloning, Expression and Immunogenicity of the Protective Antigen Subolesin in Dermacentor silvarum
Korean J Parasitol. 2014;52(1):93-97.   Published online February 19, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Gene Cloning, Expression and Immunogenicity of the Protective Antigen Subolesin in Dermacentor silvarum
Image Image Image Image Image
Fig. 1 Nucleic acid and deduced amino acid sequence of Ds4D8. The start codon is underlined and the stop codon is marked with an asterisk.
Fig. 2 Multiple alignment of 4D8 protein sequences for various tick species. Alignments were accomplished with Clustal X software. The graphic file was constructed by DNAMAN software program. GenBank accession numbers were Rhipicephalus appendiculatus, ABA62331; Rhipicephalus microplus, ABZ89745; Rhipicephalus sanguineus, ABA62332; Ixodes ricinus, ABA62325; Ixodes scapularis, AAV67031; Dermacentor silvarum, AFY52599; Dermacentor marginatus, ABA62333; Dermacentor variabilis, AAV67034; Hyalomma marginatum, ABA62335; Haemaphysalis punctata, ABA62336; Haemaphysalis qinghaiensis, ACA09713; Amblyomma americanum, ABA62326; Amblyomma hebraeum, ABY84524. The dark black shade shows identity.
Fig. 3 Phylogenetic relationship of 4D8 sequences for various tick species. The outgroup sequence is 4D8 sequences of Apis mellifera (XP_395252) and Drosophila melanogaster (AAF50569). Numbers at the nodes represent bootstrap values on 1,000 replicates. The accession numbers of the other 4D8 sequences from ticks are shown in parentheses.
Fig. 4 SDS-PAGE analysis of rDs4D8 expressed in E. coli. The E. coli lysates were electrophoresed on 10% SDS-PAGE and stained with Coomassie brilliant blue R-250. M, molecular weight marker; lane 1, IPTG-induced E. coli with pET-32 (a+); lane 2, uninduced E. coli with pET-32(a+)-4D8; Lane 3, IPTG-induced E. coli with pET-32(a+)-4D8; Lane 4, purified rDs4D8. TRX protein (22 kDa) and rDs4D8 (40 kDa) are shown by arrow.
Fig. 5 Immunogenicity analysis of the expressed rDs4D8. M, molecular weight marker; Lane 1, purified rDs4D8 incubated by rabbit anti-D. silvarum serum; Lane 2, IPTG-induced E. coli with pET-32(a+)-4D8 incubated by rabbit anti-D. silvarum serum; Lane 3, IPTG-induced E. coli with pET-32(a+)-4D8 incubated by rabbit negative serum.
Gene Cloning, Expression and Immunogenicity of the Protective Antigen Subolesin in Dermacentor silvarum
Primer name Sequence FP-RA4D85 ATGGCTTGTGCGACATTAAAGC RP-RA4D83 TTACGACAAATAGCTGGGCGTAGC FP-EcoRI-RA4D85 GAATTCATGGCTTGTGCGACATTAAAGC RP-XhoI-RA4D83 CTCGAGTTACGACAAATAGCTGGGCGTAGC
Table 1. Primer pairs used for Ds4D8 amplification by PCR

The orientation of the primer is from 5´ end to 3´ end.