Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand

The Korean Journal of Parasitology 2015;53(1):43-49.
Published online: February 27, 2015

1College of Public Health Sciences, Chulalongkorn University, Bangkok, Thailand

2Drug Discovery and Development Center, Thammasat University, Pathumthani, Thailand

3Center of Excellence in Molecular Biology and Pharmacology of Malaria and Cholangiocarcinoma, Chulabhorn International College of Medicine, Thammasat University, Patumthani, Thailand

4Graduate Program in Biomedical Sciences, Allied Health Sciences, Thammasat University, Pathumthani, Thailand

*Corresponding author (kesaratmu@yahoo.com)
• Received: June 7, 2014   • Revised: November 16, 2014   • Accepted: December 3, 2014

© 2015, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,789 Views
  • 196 Download
  • 39 Web of Science
  • 36 Crossref
  • 40 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Indigenous Plasmodium vivax upsurge in the Eastern Mediterranean, Western Pacific, and South East Asia regions – beyond the constant culpability of climate change, COVID-19, and armed conflicts
    Loick P. Kojom Foko, Amit Sharma
    International Journal for Parasitology.2025; 55(14): 755.     CrossRef
  • Low Genetic Diversity of Plasmodium vivax Circumsporozoite Surface Protein in Clinical Isolates from Southern Thailand
    Tachin Khulmanee, Thanyapit Thita, Kanyanan Kritsiriwutinan, Usa Boonyuen, Aminoh Saai, Kanjana Inkabjan, Rimi Chakrabarti, Pradipsinh K. Rathod, Srivicha Krudsood, Mathirut Mungthin, Rapatbhorn Patrapuvich
    Tropical Medicine and Infectious Disease.2024; 9(5): 94.     CrossRef
  • Drug resistance markers in Plasmodium vivax isolates from a Kanchanaburi province, Thailand between January to May 2023
    Thanawat Sridapan, Paweesuda Rattanakoch, Kaewkanha Kijprasong, Suttipat Srisutham, Kristan Alexander Schneider
    PLOS ONE.2024; 19(7): e0304337.     CrossRef
  • Investigation of Mutations in the crt-o and mdr1 Genes of Plasmodium vivax for the Molecular Surveillance of Chloroquine Resistance in Parasites from Gold Mining Areas in Roraima, Brazil
    Jacqueline de Aguiar Barros, Fabiana Granja, Rebecca de Abreu-Fernandes, Lucas Tavares de Queiroz, Daniel da Silva e Silva, Arthur Camurça Citó, Natália Ketrin Almeida-de-Oliveira Mocelin, Cláudio Tadeu Daniel-Ribeiro, Maria de Fátima Ferreira-da-Cruz
    Microorganisms.2024; 12(8): 1680.     CrossRef
  • Molecular epidemiology of potential candidate markers for chloroquine resistance in imported Plasmodium vivax malaria cases in Iran
    Sakineh Pirahmadi, Shima Afzali, Akram Abouie Mehrizi, Abbasali Raz, Ahmad Raeisi
    Malaria Journal.2023;[Epub]     CrossRef
  • Toxins from Animal Venoms as a Potential Source of Antimalarials: A Comprehensive Review
    Zeca M. Salimo, André L. Barros, Asenate A. X. Adrião, Aline M. Rodrigues, Marco A. Sartim, Isadora S. de Oliveira, Manuela B. Pucca, Djane C. Baia-da-Silva, Wuelton M. Monteiro, Gisely C. de Melo, Hector H. F. Koolen
    Toxins.2023; 15(6): 375.     CrossRef
  • Characteristics of molecular markers associated with chloroquine resistance in Plasmodium vivax strains from vivax malaria cases in Yunnan Province, China
    Hongyun Ding, Ying Dong, Yan Deng, Yanchun Xu, Yan Liu, Jing Wu, Mengni Chen, Canglin Zhang, Weibin Zheng
    Malaria Journal.2023;[Epub]     CrossRef
  • Distinct Allelic Diversity of Plasmodium vivax Merozoite Surface Protein 3-Alpha (PvMSP-3α) Gene in Thailand Using PCR-RFLP
    Kanyanan Kritsiriwuthinan, Warunee Ngrenngarmlert, Rapatbhorn Patrapuvich, Supaksajee Phuagthong, Kantima Choosang, Jianbing Mu
    Journal of Tropical Medicine.2023; 2023: 1.     CrossRef
  • Nationwide spatiotemporal drug resistance genetic profiling from over three decades in Indian Plasmodium falciparum and Plasmodium vivax isolates
    Loick P. Kojom Foko, Geetika Narang, Jahnvi Jakhan, Suman Tamang, Amit Moun, Vineeta Singh
    Malaria Journal.2023;[Epub]     CrossRef
  • Surveillance of drug resistance molecular markers in Plasmodium vivax before and after introduction of dihydroartemisinin and piperaquine in Thailand: 2009–2019
    Nutnicha Suphakhonchuwong, Kanchana Rungsihirunrat, Jiraporn Kuesap
    Parasitology Research.2023; 122(12): 2871.     CrossRef
  • Genomic analysis of Plasmodium vivax describes patterns of connectivity and putative drivers of adaptation in Ethiopia
    Alebachew Messele Kebede, Edwin Sutanto, Hidayat Trimarsanto, Ernest Diez Benavente, Mariana Barnes, Richard D. Pearson, Sasha V. Siegel, Berhanu Erko, Ashenafi Assefa, Sisay Getachew, Abraham Aseffa, Beyene Petros, Eugenia Lo, Rezika Mohammed, Daniel Yil
    Scientific Reports.2023;[Epub]     CrossRef
  • Genetic Diversity of Plasmodium vivax Merozoite Surface Protein-3 Alpha and Beta from Diverse Geographic Areas of Thailand
    Jiraporn Kuesap, Kanchana Rungsihirunrat, Wanna Chaijaroenkul, Mathirut Mungthin
    Japanese Journal of Infectious Diseases.2022; 75(3): 241.     CrossRef
  • Polymorphisms of potential drug resistant molecular markers in Plasmodium vivax from China–Myanmar border during 2008‒2017
    Zhensheng Wang, Chunyan Wei, Yunchun Pan, Zhihua Wang, Xin Ji, Qianqian Chen, Lianhui Zhang, Zenglei Wang, Heng Wang
    Infectious Diseases of Poverty.2022;[Epub]     CrossRef
  • Global scenario of Plasmodium vivax occurrence and resistance pattern
    Davinder Kaur, Shweta Sinha, Rakesh Sehgal
    Journal of Basic Microbiology.2022; 62(12): 1417.     CrossRef
  • Assessing the in vitro sensitivity with associated drug resistance polymorphisms in Plasmodium vivax clinical isolates from Delhi, India
    Monika Matlani, Amit Kumar, Vineeta Singh
    Experimental Parasitology.2021; 220: 108047.     CrossRef
  • Monitoring Plasmodium vivax resistance to antimalarials: Persisting challenges and future directions
    Marcelo U. Ferreira, Tais Nobrega de Sousa, Gabriel W. Rangel, Igor C. Johansen, Rodrigo M. Corder, Simone Ladeia-Andrade, José Pedro Gil
    International Journal for Parasitology: Drugs and Drug Resistance.2021; 15: 9.     CrossRef
  • Ten-Year Molecular Surveillance of Drug-Resistant Plasmodium spp. Isolated From the China–Myanmar Border
    Tongke Tang, Yanchun Xu, Long Cao, Penghai Tian, Jiang Shao, Yan Deng, Hongning Zhou, Bo Xiao
    Frontiers in Cellular and Infection Microbiology.2021;[Epub]     CrossRef
  • Global assessment of genetic paradigms of Pvmdr1 mutations in chloroquine-resistant Plasmodium vivax isolates
    Adel Spotin, Mahmoud Mahami-Oskouei, Ehsan Ahmadpour, Mahdi Parsaei, Ali Rostami, Shima Emami, Saba Gholipour, Mostafa Farmani
    Transactions of The Royal Society of Tropical Medicine and Hygiene.2020; 114(5): 339.     CrossRef
  • Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018
    Chaturong Noisang, Wieland Meyer, Nongyao Sawangjaroen, John Ellis, Rogan Lee
    Pathogens.2020; 9(2): 101.     CrossRef
  • Plasmodium vivax drug resistance markers: Genetic polymorphisms and mutation patterns in isolates from Malaysia
    Fei-Wen Cheong, Shairah Dzul, Mun-Yik Fong, Yee-Ling Lau, Sasheela Ponnampalavanar
    Acta Tropica.2020; 206: 105454.     CrossRef
  • Case report: recurrence of Plasmodium vivax malaria due to defective cytochrome P450 2D6 function in Pos Lenjang, Pahang, Malaysia
    Noor Hafizan Mat Salleh, Mohd Faizal Abdul Rahman, Samsiah Samsusah, Jeremy Ryan De Silva, David Chun-Ern Ng, Azilawati Hanim Ghozali, Jia Hui Tan, Meng Yee Lai, Amirah Amir, Jonathan Wee Kent Liew, Yee Ling Lau
    Transactions of The Royal Society of Tropical Medicine and Hygiene.2020; 114(9): 700.     CrossRef
  • Ex vivo susceptibilities of Plasmodium vivax isolates from the China-Myanmar border to antimalarial drugs and association with polymorphisms in Pvmdr1 and Pvcrt-o genes
    Jiangyan Li, Jie Zhang, Qian Li, Yue Hu, Yonghua Ruan, Zhiyong Tao, Hui Xia, Jichen Qiao, Lingwen Meng, Weilin Zeng, Cuiying Li, Xi He, Luyi Zhao, Faiza A. Siddiqui, Jun Miao, Zhaoqing Yang, Qiang Fang, Liwang Cui, Kamala Thriemer
    PLOS Neglected Tropical Diseases.2020; 14(6): e0008255.     CrossRef
  • An unlabelled probe-based real time PCR and modified semi-nested PCR as molecular tools for analysis of chloroquine resistant Plasmodium vivax isolates from Afghanistan
    Sayed Hussain Mosawi, Abdolhossein Dalimi, Najibullah Safi, Reza Fotouhi-Ardakani, Fatemeh Ghaffarifar, Javid Sadraei
    Malaria Journal.2020;[Epub]     CrossRef
  • Molecular surveillance for drug resistance markers in Plasmodium vivax isolates from symptomatic and asymptomatic infections at the China–Myanmar border
    Yan Zhao, Lin Wang, Myat Thu Soe, Pyae Linn Aung, Haichao Wei, Ziling Liu, Tongyu Ma, Yuanyuan Huang, Lynette J. Menezes, Qinghui Wang, Myat Phone Kyaw, Myat Htut Nyunt, Liwang Cui, Yaming Cao
    Malaria Journal.2020;[Epub]     CrossRef
  • Molecular surveillance of the Plasmodium vivax multidrug resistance 1 gene in Peru between 2006 and 2015
    Fredy E. Villena, Jorge L. Maguiña, Meddly L. Santolalla, Edwar Pozo, Carola J. Salas, Julia S. Ampuero, Andres G. Lescano, Danett K. Bishop, Hugo O. Valdivia
    Malaria Journal.2020;[Epub]     CrossRef
  • Molecular detection of drug resistant malaria in Southern Thailand
    Chaturong Noisang, Christiane Prosser, Wieland Meyer, Waenurama Chemoh, John Ellis, Nongyao Sawangjaroen, Rogan Lee
    Malaria Journal.2019;[Epub]     CrossRef
  • Promising approach to reducing Malaria transmission by ivermectin: Sporontocidal effect against Plasmodium vivax in the South American vectors Anopheles aquasalis and Anopheles darlingi
    Yudi T. Pinilla, Stefanie C. P. Lopes, Vanderson S. Sampaio, Francys S. Andrade, Gisely C. Melo, Alessandra S. Orfanó, Nágila F. C. Secundino, Maria G. V. B. Guerra, Marcus V. G. Lacerda, Kevin C. Kobylinski, Karin S. Escobedo-Vargas, Victor M. López-Sifu
    PLOS Neglected Tropical Diseases.2018; 12(2): e0006221.     CrossRef
  • The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Kritpaphat Tantiamornkul, Tepanata Pumpaibool, Jittima Piriyapongsa, Richard Culleton, Usa Lek-Uthai
    International Journal for Parasitology: Drugs and Drug Resistance.2018; 8(2): 229.     CrossRef
  • Genetic diversity of the Plasmodium vivax multidrug resistance 1 gene in Thai parasite populations
    Veerayuth Kittichai, Wang Nguitragool, Huguette Gaelle Ngassa Mbenda, Jetsumon Sattabongkot, Liwang Cui
    Infection, Genetics and Evolution.2018; 64: 168.     CrossRef
  • Molecular Evidence of Drug Resistance in Asymptomatic Malaria Infections, Myanmar, 2015
    Myat Htut Nyunt, Thinzar Shein, Ni Ni Zaw, Soe Soe Han, Fauzi Muh, Seong-Kyun Lee, Jin-Hee Han, Kyaw Zin Thant, Eun-Taek Han, Myat Phone Kyaw
    Emerging Infectious Diseases.2017; 23(3): 517.     CrossRef
  • Genetic diversity of Plasmodium vivax metacaspase 1 and Plasmodium vivax multi-drug resistance 1 genes of field isolates from Mauritania, Sudan and Oman
    Fatimata Sow, Guillaume Bonnot, Bilal Rabah Ahmed, Sidi Mohamed Diagana, Hachim Kebe, Mohamedou Koita, Ba Malado Samba, Said K. Al-Mukhaini, Majed Al-Zadjali, Seif S. Al-Abri, Osama A. M. Ali, Abdallah M. Samy, Muzamil Mahdi Abdel Hamid, Musab M. Ali Albs
    Malaria Journal.2017;[Epub]     CrossRef
  • Clinical and molecular surveillance of drug resistant vivax malaria in Myanmar (2009–2016)
    Myat Htut Nyunt, Jin-Hee Han, Bo Wang, Khin Myo Aye, Kyin Hla Aye, Seong-Kyun Lee, Ye Htut, Myat Phone Kyaw, Kay Thwe Han, Eun-Taek Han
    Malaria Journal.2017;[Epub]     CrossRef
  • Measuring ex vivo drug susceptibility in Plasmodium vivax isolates from Cambodia
    Suwanna Chaorattanakawee, Chanthap Lon, Soklyda Chann, Kheang Heng Thay, Nareth Kong, Yom You, Siratchana Sundrakes, Chatchadaporn Thamnurak, Sorayut Chattrakarn, Chantida Praditpol, Kritsanai Yingyuen, Mariusz Wojnarski, Rekol Huy, Michele D. Spring, Dou
    Malaria Journal.2017;[Epub]     CrossRef
  • Plasmodium vivax mdr1 genotypes in isolates from successfully cured patients living in endemic and non-endemic Brazilian areas
    Larissa Rodrigues Gomes, Natália Ketrin Almeida-de-Oliveira, Aline Rosa de Lavigne, Suelen Rezende Félix de Lima, Anielle de Pina-Costa, Patrícia Brasil, Cláudio Tadeu Daniel-Ribeiro, Didier Ménard, Maria de Fatima Ferreira-da-Cruz
    Malaria Journal.2016;[Epub]     CrossRef
  • Plasmodium vivax multidrug resistance-1 gene polymorphism in French Guiana
    Emilie Faway, Lise Musset, Stéphane Pelleau, Béatrice Volney, Jessica Casteras, Valérie Caro, Didier Menard, Sébastien Briolant, Eric Legrand
    Malaria Journal.2016;[Epub]     CrossRef
  • Evaluation of single nucleotide polymorphisms of pvmdr1 and microsatellite genotype in Plasmodium vivax isolates from Republic of Korea military personnel
    Dong-Il Chung, Sookwan Jeong, Sylvatrie-Danne Dinzouna-Boutamba, Hye-Won Yang, Sang-Geon Yeo, Yeonchul Hong, Youn-Kyoung Goo
    Malaria Journal.2015;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand
Korean J Parasitol. 2015;53(1):43-49.   Published online February 27, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand
Korean J Parasitol. 2015;53(1):43-49.   Published online February 27, 2015
Close
Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand
Plasmodium vivax Drug Resistance Genes; Pvmdr1 and Pvcrt-o Polymorphisms in Relation to Chloroquine Sensitivity from a Malaria Endemic Area of Thailand
Primer Sequence 5’ to 3’ nt position
Outer primer: mdrF: TTGAACAAGAAGGGGACGTT 82-101
mdrR: CTTATATACGCCGTCCTGCAC 4371-4351
crtF:GCTACCCCTAACGCACAATG -17-3
crtR: GATTTGGGAAAGCACAACGT 1853-1834
Nested primer: mdr1R:GCGTAAGATGCTAAAATGAACC 887-866
mdr2F:ATTTAACCTTTCAGAAAAGCTGT 783-805
mdr2R: CCACCTGACAACTTAGATGC 1748-1729
mdr3F: CTGATACAAGTGAGGAAGAACTAC 1600-1623
mdr3R: ACTATCCTGGTCAAAAAAGC 1757-1738
mdr4F: CCCTCTACATCTTAGTCATCG 2600-2620
mdr4R: TGGTCTGGACAAGTATCTAAAA 3531-3510
mdr5F: GGATAGTCATGCCCCAGGATTG 2751-2772
mdr5R: CATCAACTTCCCGGCGTAGC 3354-3335
mdr6F: GGAAGTTGATGTCCCTAAAGG 3344-3364
crtF:GATGAACGTTACCGGGAGTTGG 49-70
crtR: ATCGGAAGCATCAGGCAGGA 1772-1751
Amino acid residue at the codon indicated No. (%) of isolates with Pvmdr1 mutant alleles
S513R (agt/aga) 7 (23.3)
S515R (agc/agg) 30 (100)
T529 (aca/acg) T529 (aca) = 3 (10.0), T529 (acg) = 27 (90.0)
G698S (ggc/agc) 30 (100)
M908L (atg/ctg) 30 (100)
T958M (acg/atg) 30 (100)
Y976F (tac/ttc) 7 (23.3)
L1022 (cta/tta) L1022 (cta) = 30 (100)
F1076L (ttt/ctt) 16 (53.3)
Frequency distribution of the 5 haplotypes in Pvmdr1
 - 515R+ 698S+ 908L+ 958M (4 mutations) 8 (26.7)
 - 513R+ 515R+ 698S+ 908L+ 958M (5 mutations) 6 (20.0)
 - 515R+ 698S+ 908L+ 958M+ 1,076L (5 mutations) 8 (26.7)
 - 513R+ 515R+ 698S+ 908L+ 958M+1,076L (6 mutations) 1 (3.3)
 - 515R+ 698S+ 908L+ 958M + 976F+ 1,076L (6 mutations) 7 (23.3)
Median (range) Chloroquine IC50 (nM)
S513R S (n=12) 132.56 (39.99-243.17)
R (n=3) 141.99 (81.86-248.86)
S515R R (n=15) 137.04 (39.99-248.86)
T529 T (aca) (n=1) 43.24
T (acg) (n=14) 139.52 (39.99-248.86)
G698S S (n=15) 137.04 (39.99-248.86)
M908L L (n=15) 137.04 (39.99-248.86)
T958M M (n=15) 137.04 (39.99-248.86)
Y976F Y (n=13) 137.04 (39.99-248.86)
F (n=2) 165.19 (87.21-243.17)
L1022 L (cta) (n=15) 137.04 (39.99-248.86)
F1076L F (n=6) 119.41 (39.99-248.86)
L (n=9) 137.04 (43.24-243.17)
Chloroquine resistant Chloroquine sensitive
S513R S 7 5
R 2 1
S515R R 6 9
T529 T (aca) 0 1
T (acg) 9 5
G698S S 9 6
M908L L 9 6
T958M M 9 6
Y976F F 1 1
Y 8 5
L1022 L (cta) 9 6
F1076L F 3 3
L 6 3
Table 1. List of PCR primers for amplification of PvmdrI and Pvcrt-o genes
Table 2. Frequency distribution of mutation at each codon and haplotype in Pvmdr1 gene of 30 P. vivax isolates
Table 3. The polymorphisms in Pvmdr1 gene at the 4 highly polymorphic loci (S513R, Y976F, F1076L, and T529) including the other 5 loci and IC50 values of 15 selected P. vivax isolates with wild-type and mutant genotypes

Data are presented as number of isolates (n) and median (range) IC50 values.

Table 4. The association between polymorphisms in Pvmdr1 gene at the 4 highly polymorphic loci (S513R, Y976F, F1076L, T529) including the other 5 loci and in vitro susceptibilities of 15 selected P. vivax isolates to chloroquine classified based on the in vitro IC50 cut-off of 100 nM

Data are presented as number of isolates (n).