Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice

The Korean Journal of Parasitology 2007;45(4):255-266.
Published online: December 20, 2007

1Laboratório de Biologia Molecular, Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, MG, Brazil.

2Laboratório de Imunologia Celular e Humoral do Instituto Oswaldo Cruz, Rio de Janeiro, RJ, Brazil.

3Laboratório de Patologia, Universidade Federal de Uberlândia, MG, Brazil.

4Northwestern University Feinberg School of Medicine, Chicago, IL, USA.

5Serviço de Infectologia, Hospital de Clínicas, Universidade Federal de Uberlândia, Uberlândia, MG, Brazil.

Corresponding author (masouza@ufu.br)
• Received: June 20, 2007   • Accepted: November 12, 2007

Copyright © 2007 by The Korean Society for Parasitology

  • 12,009 Views
  • 97 Download
  • 15 Crossref
  • 15 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Review on macrophage polarization during visceral leishmaniasis and impact of glycoprotein
    Nayanika Datta, Sajal Dasmahapatra, Madhusri Pramanik, Santanu Kar Mahapatra
    Glycoconjugate Journal.2026;[Epub]     CrossRef
  • Partial characterization of purified glycoprotein from nutshell of Arachis hypogea L. towards macrophage activation and leishmaniacidal activity
    Sujatha Srinivasan, Mamilla R. Charan Raja, Amrita Kar, Aishwarya Ramasamy, Adithyan Jayaraman, Vellingiri Vadivel, Santanu Kar Mahapatra
    Glycoconjugate Journal.2023; 40(1): 1.     CrossRef
  • Microgramma vacciniifolia Frond Lectin: In Vitro Anti-leishmanial Activity and Immunomodulatory Effects Against Internalized Amastigote Forms of Leishmania amazonensis
    Lethícia Maria de Souza Aguiar, Michel Muálem de Moraes Alves, Enoque Pereira Costa Sobrinho Júnior, Patrícia Maria Guedes Paiva, Fernando Aécio de Amorim Carvalho, Lidiane Pereira de Albuquerque, Leydianne Leite de Siqueira Patriota, Thiago Henrique Napo
    Acta Parasitologica.2023; 68(4): 869.     CrossRef
  • Plant-derived immuno-adjuvants in vaccines formulation: a promising avenue for improving vaccines efficacy against SARS-CoV-2 virus
    Arbind Kumar, Aashish Sharma, Narendra Vijay Tirpude, Yogendra Padwad, Vipin Hallan, Sanjay Kumar
    Pharmacological Reports.2022; 74(6): 1238.     CrossRef
  • Ovicidal and toxicological effect of hydroalcoholic extracts of Euphorbia milli var splendens, Synadenium carinatum Boiss and Tagetes minuta L. against Ancylostoma spp.: In vitro study
    Matheus Diniz Gonçalves Coêlho, Lucas Tobias Rodrigues Maciel, Thaís de Fátima Kieko Ozaki, Maria Eduarda Godoi Silva, Lilian Saito Ormachea Bozo, Yumi Ando Consoli, Fernanda Bueno Sant’Anna Pereira-Maciel, Gokithi Akisue, Francine Alves da Silva-Coêlho
    Journal of Parasitic Diseases.2021; 45(1): 252.     CrossRef
  • Edwardsiella piscicida Type III Secretion System Effector EseK Inhibits Mitogen-Activated Protein Kinase Phosphorylation and Promotes Bacterial Colonization in Zebrafish Larvae
    Huifang Cao, Fajun Han, Jinchao Tan, Mingyu Hou, Yuanxing Zhang, Dahai Yang, Qin Liu, Shelley M. Payne
    Infection and Immunity.2018;[Epub]     CrossRef
  • Plant lectins ConBr and CFL modulate expression toll-like receptors, pro-inflammatory cytokines and reduce the bacterial burden in macrophages infected with Salmonella enterica serovar Typhimurium
    JEC Batista, MT Ralph, RV Vaz, PFC Souza, AB Silva, DCO Nascimento, LT Souza, MV Ramos, P Mastroeni, JV Lima-Filho
    Phytomedicine.2017; 25: 52.     CrossRef
  • Targeting the Immune System with Plant Lectins to Combat Microbial Infections
    Jannyson J. B. Jandú, Roberval N. Moraes Neto, Adrielle Zagmignan, Eduardo M. de Sousa, Maria C. A. Brelaz-de-Castro, Maria T. dos Santos Correia, Luís C. N. da Silva
    Frontiers in Pharmacology.2017;[Epub]     CrossRef
  • Lectins from Synadenium carinatum (ScLL) and Artocarpus heterophyllus (ArtinM) Are Able to Induce Beneficial Immunomodulatory Effects in a Murine Model for Treatment of Toxoplasma gondii Infection
    Eliézer L. P. Ramos, Silas S. Santana, Murilo V. Silva, Fernanda M. Santiago, Tiago W. P. Mineo, José R. Mineo
    Frontiers in Cellular and Infection Microbiology.2016;[Epub]     CrossRef
  • Porifera Lectins: Diversity, Physiological Roles and Biotechnological Potential
    Johan Gardères, Marie-Lise Bourguet-Kondracki, Bojan Hamer, Renato Batel, Heinz Schröder, Werner Müller
    Marine Drugs.2015; 13(8): 5059.     CrossRef
  • Adjuvant and immunostimulatory effects of a D-galactose-binding lectin from Synadenium carinatum latex (ScLL) in the mouse model of vaccination against neosporosis
    Mariana R D Cardoso, Caroline M Mota, Dâmaso P Ribeiro, Pablo G Noleto, William B F Andrade, Maria A Souza, Neide M Silva, Tiago W P Mineo, José R Mineo, Deise A O Silva
    Veterinary Research.2012;[Epub]     CrossRef
  • Effect of the Synadenium carinatum latex lectin (ScLL) on Leishmania (Leishmania) amazonensis infection in murine macrophages
    Sandra R. Afonso-Cardoso, Claudio Vieira Silva, Marcelo S. Ferreira, Maria A. Souza
    Experimental Parasitology.2011; 128(1): 61.     CrossRef
  • A lactose specific lectin from the sponge Cinachyrella apion: Purification, characterization, N-terminal sequences alignment and agglutinating activity on Leishmania promastigotes
    Danielle S. Medeiros, Thales L. Medeiros, Jannison K.C. Ribeiro, Norberto K.V. Monteiro, Ludovico Migliolo, Adriana F. Uchoa, Ilka Maria Vasconcelos, Adeliana S. Oliveira, Maurício. P. de Sales, Elizeu A. Santos
    Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology.2010; 155(3): 211.     CrossRef
  • Mechanism of Trypanosoma cruzi death induced by Cratylia mollis seed lectin
    M. P. Fernandes, N. M. Inada, M. R. Chiaratti, F. F. B. Araújo, F. V. Meirelles, M. T. S. Correia, L. C. B. B. Coelho, M. J. M. Alves, F. R. Gadelha, A. E. Vercesi
    Journal of Bioenergetics and Biomembranes.2010; 42(1): 69.     CrossRef
  • Angiogenic activity of Synadenium umbellatum Pax latex
    PR. Melo-Reis, LS. Andrade, CB. Silva, LMM. Araújo, MS. Pereira, F. Mrue, L. Chen-Chen
    Brazilian Journal of Biology.2010; 70(1): 189.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice
Korean J Parasitol. 2007;45(4):255-266.   Published online December 20, 2007
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice
Korean J Parasitol. 2007;45(4):255-266.   Published online December 20, 2007
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice
Image Image Image Image Image
Fig. 1 ScLL effect in the lesion progression of L. amazonensis-infected BALB/c mice and parasite burden. BALB/c mice were immunized and infected with 106 stationary promastigotes of Leishmania and monitored for 10 weeks after infection. (A) Mice immunized with 25 µg/animal of SLA, SLA plus ScLL (10, 50 or 100 µg/animal), and control. (B) Mice immunized with 25 µg/animal of SLA, ScLL (10, 50 or 100 µg/animal), and control. Bars indicate the average and the standard deviation of differences between the average of the infected and uninfected footpads (n = 5). (C) Parasite burden in the footpad of immunized BALB/c mice with SLA and/or ScLL and infected by L. amazonensis. The results express the average and the standard deviation of the number of parasites by field into infected macrophages. ***P < 0.0001.
Fig. 2 DTH measurements. At the 10th week after infection with L. amazonensis, the immunized mice received 50 µg SLA antigen on the uninfected contralateral footpad. After 48 hr, the reading of the skin endurance was carried out as described in Materials and Methods. SLA (25 µg/animal) alone, SLA (25 µg/animal) plus ScLL (10, 50 or 100 µg/animal), PBS (control), and ScLL (10, 50 or 100 µg/animal) group mice. Bars indicate median for the measurement of the skin endurance in each group (n = 5). The line indicates 0.05 mm.
Fig. 3 Serum levels of specific anti-Leishmania immunoglobulins. At the 10th week after infection, the animals were bled and evaluated according to the level of specific antibodies by ELISA. Control (PBS) mice, and mice immunized with SLA (25 µg/animal) alone, SLA (25 µg/animal) plus ScLL (10, 50 or 100 µg/animal), and ScLL (10, 50 or 100 µg/animal) were analyzed. C (-) represents the sera of unimmunized and uninfected mice. (A) Levels of anti-Leishmania total IgG. (B) Levels of anti-Leishmania IgG1. (C) Levels of anti-Leishmania IgG2a. Bars express the average and the standard deviation of optical density (OD) at 492 nm in serum samples of each group (n = 5). *P < 0.05; **P < 0.0084; ***P < 0.0001.
Fig. 4 Histopathological features. (A) PBS group (skin) showing mononuclear exudate, neutrophils in the dermis and hypodermis, and parasitism of macrophages (arrowheads). (B) PBS group (popliteal lymph node) showing multinuclear giant cells with parasites, vacuoles with numerous amastigote forms in the periphery (arrowheads). (C) SLA group (skin) parasitism of the elongated cells of dermis compatible with fibroblasts (arrowheads). (D) SLA group (popliteal lymph node) parasitism of macrophages (arrowheads). (E) SLA + 100 µg/animal ScLL group (skin) parasitism of epidermal keratinocytes (arrowheads). (F) SLA + 100 µg/animal ScLL group (popliteal lymph node) eosinophilic exudate, and parasitism of macrophages (arrowheads). (G) 100 µg/animal ScLL group (skin) parasite-containing macrophages (arrowheads) and dermal fibroblasts. (H) 100 µg/animal ScLL group (popliteal lymph node) parasitism of macrophages (arrowheads). Data are representative of all immunized and infected mice with L. amazonensis. H-E stain. Original magnifications × 1,000.
Fig. 5 Expression and relative intensity of cytokines and iNOS by conventional RT-PCR assay in the lesion footpads of immunized mice and mice challenged with L. amazonensis. GAPDH expression was used as normal patterns of mRNA expression. Bars represent the relative intensity of the cytokines and iNOS expression. SLA corresponded to immunizing mice with SLA alone; SLA+10 µg, SLA+50 µg, SLA+100 µg corresponded to immunizing mice with SLA+ScLL 10 µg/animal, SLA+ScLL 50 µg/animal, SLA+ScLL 100 µg/animal, respectively; 10 µg, 50 µg, 100 µg, corresponded to immunizing mice with ScLL 10 µg/animal, ScLL 50 µg/animal, ScLL 100 µg/animal, respectively; and control corresponded to immunizing mice with PBS. C (-): negative reaction control.
Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice
Target Oligonucleotide sequence (5'-3')
Forward Reverse IL-4 TCATCGGCATTTTGAACGAG GCACCTTGGAAGCCCTACAG IL-12p35 AGACCAGAGACATGGAGTCATA TGCTTCACACTTCAGGAAAG IFN-γ GCAACAGCAAGGCGAAAAAG AAATTCAAATAGTGCTGGCAGAA TNF-α GATCTCAAGACAACCAACATGTG CTCCAGCTGGAAGACTCCTCCCAG iNOS GATGGTCAAGATCCAGAGAGGTCT AATTCGAGGCCACCCACC GAPDH CATGGCCTTCCGTGTTCCTA GGTCCTCAGTAGCCCAAGAT
Table 1. Primer sequences used in this study