Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

The Effect of ABO Blood Groups, Hemoglobinopathy, and Heme Oxygenase-1 Polymorphisms on Malaria Susceptibility and Severity

The Korean Journal of Parasitology 2018;56(2):167-173.
Published online: April 30, 2018

1Faculty of Allied Health Sciences, Thammasat University. Pathumthani, ThailandJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

2Chulabhorn International College of Medicine, Thammasat University, Pathumthani, Thailand

*Corresponding author (kesaratmu@yahoo.com)
• Received: November 12, 2017   • Revised: March 20, 2018   • Accepted: April 10, 2018

Copyright © 2018 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12,048 Views
  • 197 Download
  • 12 Web of Science
  • 15 Crossref
  • 16 Scopus
prev next
  • Malaria is one of the most important public health problems in tropical areas on the globe. Several factors are associated with susceptibility to malaria and disease severity, including innate immunity such as blood group, hemoglobinopathy, and heme oxygenase-1 (HO-1) polymorphisms. This study was carried out to investigate association among ABO blood group, thalassemia types and HO-1 polymorphisms in malaria. The malarial blood samples were collected from patients along the Thai-Myanmar border. Determination of ABO blood group, thalassemia variants, and HO-1 polymorphisms were performed using agglutination test, low pressure liquid chromatography and polymerase chain reaction, respectively. Plasmodium vivax was the major infected malaria species in the study samples. Distribution of ABO blood type in the malaria-infected samples was similar to that in healthy subjects, of which blood type O being most prevalent. Association between blood group A and decreased risk of severe malaria was significant. Six thalassemia types (30%) were detected, i.e., hemoglobin E (HbE), β-thalassemia, α-thalassemia 1, α-thalassemia 2, HbE with α-thalassemia 2, and β-thalassemia with α-thalassemia 2. Malaria infected samples without thalassemia showed significantly higher risk to severe malaria. The prevalence of HO-1 polymorphisms, S/S, S/L and L/L were 25, 62, and 13%, respectively. Further study with larger sample size is required to confirm the impact of these 3 host genetic factors in malaria patients.
The widespread of malaria infection is a major public health problem in tropical and sub-tropical areas especially in Africa and Southeast Asia including Thailand. Several host factors such as innate immunity [1], hemoglobinopathy [2], and heme oxygenase (HO) polymorphisms [3,4] were investigated for the possible relationship with susceptibility to malaria and disease severity. Different geographic distributions and different ethnic populations are associated with different genetic variants to protect malaria [5]. The Plasmodium parasites are directly related to host red blood cells and therefore pathology of red blood cells could be expected to influence malaria infection and severity.
The possible association between patient ABO blood groups and malaria development and severity has been suggested since 1957. The frequencies of blood group antigens were determined in Nigerian children with severe falciparum malaria [6,7]. The relationship between ABO blood group and severity of malaria disease was also investigated in other populations with the focus on Plasmodium falciparum infection [813]. Significant association between ABO blood group and severe P. falciparum infection was demonstrated in different populations, i.e., in patients with blood group A in Zimbabwe [8], Gabon [9], and Ethiopia [10], in patients with blood group AB in Sri Lanka [11], Mali [12], and Ethiopia [10], and in patients with blood group B in India [13]. Falciparum malaria patients with blood group O was shown to be significantly associated with protection against cerebral malaria, whereas those with blood groups A and B was significantly associated with increased risk of developing cerebral malaria in Indian population [14]. The association between ABO blood group and anemia induced by Plasmodium vivax infection was investigated in Brazilian patients and results suggested increased susceptibility to anemia in P. vivax patients with blood group O [15].
Thalassemia is a hemoglobinopathy caused by the alterations of globin chain synthesis that is classified into 2 forms based on the abnormality of globin chains, i.e., α and β-thalassemia. Thalassemia is widely distributed and commonly found in malaria endemic areas [16]. Previous studies demonstrated protective effect against malaria of thalassemic red cells including hemoglobin E [17], α-thalassemia [2,18], and β-thalassemia [19,20].
The association between human heme oxygenase-1 (HO-1) polymorphisms and malaria infection was described in a few studies in different populations, i.e., Gambian [21], Malawian [22], Angolan [23], and Burmese [3] populations. HO-1 is an inducible enzyme responsible for the breakdown of heme, mainly from hemoglobin into carbon monoxide (CO), biliverdin, and iron [24]. The HO-1 gene promoter contains a polymorphic (GT)n repeat which influences the expression level of HO-1 enzyme. HO-1 is beneficial for malaria parasite for growth and survival within red blood cells, for iron supply from the hemoglobin degradation process. The malaria parasite lacks HO-1 and is unable to cleave heme to release iron. In malaria infected thalassemic red cells particularly those with Hb E, the most common types in Thai population [17,25], the property of red blood cells is changed from normal which might affect iron supply for malaria parasite [26], and as a consequence the level of HO-1.
The aim of the study was to investigate the association of ABO blood group, thalassemia variants, and HO-1 polymorphisms in malaria infected blood samples collected from areas along the Thai-Myanmar border.
Study subjects and sample collection
A total of 100 blood samples (5 ml each) were collected from malaria patients who attended malaria clinics and general hospitals in malaria endemic areas along the Thai-Myanmar (Kanchanaburi and Ranong Provinces). The inclusion criteria were: patients infected with all species of malaria; both males and females; and age 18–65 years. Patients who had received previous treatment within 28 days were excluded from the study. The study protocol was approved by the Ethics Committee of Thammasat University (COA No. 012/2558). Giemsa-stained thin and thick blood smears were prepared and examined under the light microscope for the presence of malaria parasites.
ABO blood group typing
ABO blood group was determined in all malaria infected blood samples by standard agglutination test using agglutinating A, B, and AB monoclonal anti-sera obtained from The Thai Red Cross Society (Bangkok, Thailand).
Analysis on thalassemic variants and other hematologic parameters
Osmotic hemolysis of malaria infected red blood cells was screened by osmotic fragility test (OF test). Hemoglobin typing was performed using automated low pressure liquid chromatography (LPLC) (Automated analyzer, Hb Gold, Cumbria, UK). The common α-thalassemia variants α-thalassemia-1 (SEA and Thai), α-thalassemia-2 (3.7 and 4.2), and Hb constant spring were analyzed using multiplex polymerase chain reaction (PCR). The hematological parameters including hemoglobin, hematocrit, mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) were analyzed using hematology analyzer (DxH, Coulter, Miami, USA).
Analysis on severity of anemia and malaria disease
The severity of anemic status of malaria infected blood samples was classified as mild, moderate and severe anemia according to the criteria of the World Health Organization [27]. Non-anemic condition was defined as hemoglobin level of >13.0 and >12.0 mg/dl for males and females, respectively. Mild degree of anemia was defined as hemoglobin levels of 11.0–12.9 and >11–11.9 mg/dl for samples collected from males and females, respectively. Moderate and severe anemic conditions in samples from both genders were defined as hemoglobin levels of 8.0–10.9 and <8.0 g/dl, respectively. Hyperparasitemia was defined as patients with >2% parasitemia or parasite count >100,000/μl in low intensity transmission areas [28]. Malaria disease severity of all blood samples was classified based on the 2 laboratory criteria, i.e., anemia (hemoglobin and hematocrit levels) and hyperparasitemia (blood parasitemia count). The risk of patients to develop severe malaria based on analysis of the infected red blood cells was defined as: “high risk” if blood parasitemia was >100,000/μl and/or hemoglobin <8.0 and/or hematocrit <20% [27,28].
Preparation of genomic DNA
Genomic DNA of all blood samples was prepared using a QIAamp DNA extraction mini-kit (QIAGEN, Valencia, California, USA) according to manufacturer’s instruction and used as a template for polymerase chain reaction (PCR) amplification.
Analysis on HO-1 polymorphisms
The 5′-flanking region of the HO-1 gene containing the (GT) n repeat was amplified by PCR using the forward primer ACGCCTGGGGTGCATCAAGTC and the reverse primer GTGGGGTGGAGAGGAGCAGTCATA [29]. The gene was amplified in a thermocycler (T100TM Thermal cycler, BioRad) under the following cycling conditions: 5 min denaturation at 94°C followed by 30 cycles of 45 sec at 94°C, 30 sec at 65°C and 45 sec at 72°C, and a final extension step at 72°C for 2 min. The PCR products were subjected to high solution electrophoresis and the fragment sizes were compared with (GT) 27 repeat DNA. The alleles consisting of less than (GT) 27 repeat were classified as S (short) alleles, and those consisting of (GT) 27 repeat or longer were classified as L (long) alleles.
Statistical analysis
Statistical analysis was performed using the SPSS statistical package (version 12.0 SPSS Inc., Chicago, Illinois, USA). The frequencies of malaria species, ABO blood group, and types of thalassemia are summarized as percentage (%). Levels of parasitemia, hemoglobin, hematocrit, MCV and MCH are summarized as median and range for data not conforming to normal distribution. Differences in qualitative and quantitative data between groups were analyzed using chi-square test and Kruskal-Wallis Test, respectively. Pair-wise comparison of the statistically significant Kruskal-Wallis test was performed using Mann-Whitney test. Statistical significance level was set at α=0.05 for all tests.
A total of 100 blood samples were collected from 62 males and 38 females (27 Thais and 73 Burmeses, aged 18–60 years) with mono- or mixed infection with P. falciparum and/or P. vivax. Of the 100 malaria infected blood samples collected, mono-infection with either P. falciparum or P. vivax accounted for 35% and 63%, respectively; mixed infection of both species accounted for 2% of the samples. The median (range) of parasitemia in all samples was 4,205 (50–80,300)/μl, while those with mono-infection with P. falciparum, P. vivax and mixed infection of both species were 7,764 (355–80,300), 3,618 (50–74,667), and 12,820 (2,920–22,720)/μl, respectively.
Association between ABO blood group and occurrence of malaria infection and severity
The highest frequency of ABO blood group in the samples was O (37%), followed by B (31%), A (25%), and AB (7%). No significant association between ABO blood group and susceptibility of malaria infection was found (Table 1). The distribution of all types of malaria infections was not significantly different in all blood groups, although proportion of samples with blood group O with P. vivax infection was about 3 times higher than that with P. falciparum infection. The association between the ABO blood group and severity of malaria infection was further determined based on parasitemia, and anemic status (hemoglobin and hematocrit levels). Based on these criteria, proportion of patients with high risk of developing severe malaria was significantly higher in blood group A compared with other blood groups (P =0.026) (Table 2).
Association between prevalence of thalassemic variants and occurrence of malaria infection
The prevalence of thalassemia in the samples was 30%. Among 6 common types, i.e., Hb E, β-thalassemia, α-thalassemia-1, α-thalassemia-2, Hb E/α-thalassemia-2, and β-thalassemia/α-thalassemia-2, Hb E and α-thalassemia-2 accounted for the majority of all types (14% and 10%, respectively) (Table 3). Only 1 sample with α-thalassemia-1 was SEA deletion. All samples with α-thalassemia-2 were 3.7 kb gene deletion.
The association between thalassemia variants and the infected malaria species, parasitemia, hemoglobin, hematocrit, MCV, and MCH were investigated. Results suggested significant effects of these red blood cell parameters of the thalassemia in the malaria infected samples. Significant difference in hematocrit, but not hemoglobin level was found between malaria infected samples without thalassemia and those with all types of thalassemia (Table 3). The MCV of malaria infected samples with HbE, α-thalassemia 2 and β/α-thalassemia 2 were significantly different from those malaria infected samples with or without thalassemia. In addition, the MCH of malaria infected samples with HbE, β-thalassemia and β/α-thalassemia 2 were significantly different from those malaria infected samples with or without thalassemia.
The associations between malaria infected samples with or without thalassemia and anemic status (non-anemia, mild anemia, moderate anemia, and severe anemia) were investigated and results are summarized in Table 4. Significant association between malaria infected samples with and without thalassemia was found. β-thalassemia and Hb E/α-thalassemia 2 were significantly associated with the anemic status. In malaria infected samples without thalassemia, the proportion of severe anemia was significantly lower than that with thalassemia.
Association between heme oxygenase-1 promotor genotypes and malaria disease severity
The number of (GT)n repeat of the HO-1 gene in the malaria infected samples ranged from 13 to 39. The size of HO-1 gene was categorized as short (S: 13–26 repeats), and long (L: 27–39 repeats). The allele frequencies of (GT) n allele in each sample was further classified into 3 genotypes, i.e., S/S, S/L, and L/L (Table 5). There was no association between HO-1 promotor genotype and the risk of development of severe malaria.
Relationship between ABO blood group, thalassemia status, HO-1 genotypes and malaria severity
The relationships between the 3 host genetic factors in malaria infected samples were investigated. Results showed no significant association between ABO blood group and thalassemia type (P =0.149), ABO blood group and HO-1 polymorphisms (P=0.890), as well as thalassemia type and HO-1 polymorphisms (P =0.811).
The ABO blood group distribution found in the samples analyzed in the present study was similar to that previously reported in other studies in Thailand [3032]. The most prevalent blood group was O (37%). The most prevalent blood group in blood samples infected with P. falciparum and P. vivax were B and O, respectively. It was noted however that the proportion of samples infected with P. vivax with blood group O was about 3 times of P. falciparum. This observation may suggest increased susceptibility to P. vivax infection compared with P. falciparum infection in patients with blood group O. Blood samples with A antigen on red blood cells (blood group A and AB) were not found in samples identified as high risk of developing severe malaria. It is possible that patients with blood group A and AB are more likely protected from severe malaria.
The association between thalassemia and malaria disease was investigated in several studies and the protective effect against P. falciparum malaria by different types of thalassemic red cells was demonstrated. These include hemoglobin E [17], α-thalassemia [2,18], and β-thalassemia [19,20]. In Southeast Asia, the major type of thalassemia is Hb E [33]. In the present study, the most prevalent thalassemia variants found in 100 malaria infected, both P. falciparum and P. vivax infected samples, were Hb E and α-thalassemia-2. Different types of thalassemia had different degree of impact on the anemic status of the malaria infected samples. The β-thalassemia and Hb E/α-thalassemia 2 were significantly associated with severe anemia and the risk to development of severe malaria.
The association between HO-1 promotor genotypes and malaria infection was investigated in various populations. Elevated HO-1 expression was associated with severe malaria in Gambian children [21] and with cerebral malaria in Malawian [22], Burmese [3] and Angolan children [23]. The association between HO-1 polymorphism and malaria disease severity was initially proposed by Shibahara et al. [24,34]. Later studies provided supporting evidence on the association between (GT)n repeat polymorphisms of HO-1 and malaria severity in Karen ethnic minority group in Myanmar [3], and Thai, Burmese and Karen patients in Thailand [4]. The proportion of Karen patients with short (GT) n alleles was found to be significantly higher in cerebral malaria than uncomplicated malaria [3]. Significant difference in HO-1 genotypes was found among 3 ethnics patients that may explain difference in pathogenicity/severity of malaria infection in various ethnics. Nevertheless, the relationship between ABO blood group, thalassemia type, HO-1 polymorphisms and malaria disease severity were not found in the present study. This could be explained by the observed low prevalence of S/S genotype and high proportion of samples with P. vivax infection with a typical characteristic of low parasitemia compared with P. falciparum infection.
In conclusion, malaria infected red blood cells with β-thalassemia and Hb E/α-thalassemia 2 are more likely to develop severe malaria. Those with blood group A and AB are more likely to protect patients from the risk of developing severe malaria. Further study with increasing sample size should be performed to confirm the impacts of these 3 host genetic factors, i.e., ABO blood groups, thalassemia types, and HO-1 polymorphisms, in malaria patients.
The study was supported by The Thailand Research Fund (TRF) Grant for new researcher and Thammasat University (TU) Research Fund (contract no. TRG5880215).
Table 1
The distribution of ABO blood group and malaria species infected in 100 blood samples
Table 1
Plasmodium species O (%) A (%) B (%) AB (%) Total (%)
Plasmodium falciparum 9 11 12 3 35
Plasmodium vivax 27 13 19 4 63
Mixed infections with P. falciparum and P. vivax 1 1 0 0 2
Total 37 25 31 7 100
Table 2
The distribution of ABO blood group and risk of developing severe malaria based on parasitemia and the anemic status of patients (levels of hemoglobin and hematocrit)
Table 2
Variables Distribution in ABO group

O A B AB
Parasitemia (median and range, /μl blood)
Plasmodium falciparum 15,776 (461–80,300) 7,200 (800–41,429) 9,703 (355–70,095) 1,608 (1,600–2,300)
Plasmodium vivax 4,705 (64–74,667) 3,909 (50–12,000) 2,583 (150–42,988) 12,075 (1,563–12,808)
 Mixed infections with P. falciparum and P. vivax 2,920 (2,920–2,920) 22,720 (22,720–22,720) - -

Hemoglobin (%)
 Non-anemia (male ≥13, female ≥12 g/dl) 14 13 15 4
 Mild anemia (male 11–12.9, female 11–11.9 g/dl) 13 8 8 0
 Moderate anemia (8.0–10.9 g/dl for both genders) 6 5 3 2
 Severe anemia (<8.0 g/dl for both genders) 4 0 5 0

Hematocrit (%)
 ≥20 37 26 28 6
 <20 0 0 3 0

Risk of developing severe malaria (%)
 Low risk 30 25 25 7
 High risk (parasitemia (≥70,000/μl) and/or hemo- globin (<8.0) and/or hematocrit <20% 7 0a 6 0

aStatistically significant difference from patients with other blood groups (P =0.026).

Table 3
The prevalence of thalassemia in 100 malaria infected samples
Table 3
Thalassemia No. (%) Malaria Type Hb (g/dL) Hct (%) MCV (fl) MCH (pg)

PF PV Mixed
Malaria with thalassemia 30 9 20 1 11.5 (5.1–14.3) 34.3 (15.9–44.1) 71.0 (53.0–91.0) 23.2 (15.2–30.2)
 Hb E 14 3 10 1 11.8 (7.8–14.3) 35.5 (21.9–43.0) 73.5 (63.0–83.0)b 24.1 (20.5–27.4)f
 β-thalassemia 1 1 0 0 6.0 (6.0–6.0) 18.0 (18.0–18.0) 58.0 (58.0–58.0) 18.7 (18.7–18.7)g
 α-thalassemia 1 1 1 0 0 12.7 (12.7–12.7) 41.3 (41.3–41.3) 68.7 (68.7–68.7) 21.2 (21.2–21.2)
 α-thalassemia 2 10 3 7 0 12.0 (5.1–14.3) 35.5 (15.9–44.1) 73.5 (53.0–91.0)c 23.8 (15.2–30.2)
 Hb E/α-thalassemia 2 1 0 1 0 7.6 (7.6–7.6) 24.0 (24.0–24.0) 62.0 (62.0–62.0) 19.7 (19.7–19.7)
 β/α-thalassemia 2 3 1 2 0 10.9 (9.8–11.1) 33.6 (28.3–34.3) 67.0 (60.0–67.0)d 21.3 (19.6–22.7)h

Malaria without thalassemia 70 26 43 1 12.4 (3.4–17.7) 37.7 (10.7–55.1)a 84.5 (50.0–101.0)e 27.80 (20.8–32.3)i

aStatistically significant difference from samples with thalassemia (P=0.006).

bStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.002).

cStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.045).

dStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.007).

eStatistically significant difference from samples with thalassemia (P<0.001).

fStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.001).

gStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.043).

hStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.006).

iStatistically significant difference from patients with thalassemia (P<0.001).

Table 4
The association of thalassemia and anemic status in malaria infected samples
Table 4
Thalassemia Anemic status

Non- anemia (%) Mild anemia (%) Moderate anemia (%) Severe anemia (%)
Malaria with thalassemiaa 10 7 7 6
 Hb E 6 2 4 2
 β-thalassemiab 0 0 0 1
 α-thalassemia 1 0 1 0 0
 α-thalassemia 2 4 3 1 2
 Hb E/α-thalassemia 2c 0 0 0 1
 β/α-thalassemia 2 0 1 2 0

Malaria without thalassemia 36 20 11 3d

aStatistically significant difference from patients with thalassemia (P=0.016).

bStatistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

cStatistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

dStatistically significant difference from patients with other types of thalassemia (P=0.019).

Table 5
Distribution of HO-1 promoter genotypes (S and L) including allele (S/S, S/L, and L/L) frequencies and malaria severity in 100 malaria infected samples
Table 5
Number Malaria species Malaria severity


P. falciparum P. vivax Mixed infection UM RSM
Alleles, n (%)
 S 112 (56)
 L 88 (44)

Genotypes, (%)
 S/S 25 8 16 1 22 3
 S/L 62 25 37 0 53 9
 L/L 13 2 10 1 12 1

UM, uncomplicated malaria; RSM, risk to severe malaria.

  • 1. Stevenson M, Riley M. Innate immunity to malaria. Nat Rev Immunol 2004;4:169-180.
  • 2. Weatherall DJ. Thalassaemia and malaria, revisited. Ann Trop Med Parasitol 1997;91:885-890.
  • 3. Takeda M, Kikuchi M, Ubalee R, Na-Bangchang K, Ruangweerayut R, Shibahara S, Imai S, Hirayama K. Microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with susceptibility to cerebral malaria in Myanmar. Jpn J Infect Dis 2005;58:268-271.
  • 4. Kuesap J, Hirayama K, Kikuchi M, Ruangweerayut R, Na-Bangchang K. Study on association between genetic polymorphisms of haem oxygenase-1, tumour necrosis factor, cadmium exposure and malaria pathogenicity and severity. Malar J 2010;9:260.
  • 5. Campino S, Kwiatkowski D, Dessein A. Mendelian and complex genetics of susceptibility and resistance to parasitic infections. Semin Immunol 2006;18:411-422.
  • 6. Allison AC. Protection afforded by sickle cell trait against subtertian malarial infection. Br Med J 1954;1:290-294.
  • 7. Martin SK, Miller LH, Hicks CU, David-West A, Ugbode C, Deane M. Frequency of blood group antigens in Nigerian children with falciparum malaria. Trans R Soc Trop Med Hyg 1979;73:216-318.
  • 8. Fischer PR, Boone P. Short report: severe malaria associated with blood group. Am J Trop Med Hyg 1998;58:122-123.
  • 9. Lell B, May J, Schmidt-Ott RJ, Lehman LG, Luckner D, Greve B, Matousek P, Schmid D, Herbich K, Mockenhaupt FP, Meyer CG, Bienzle U, Kremsner PG. The role of red blood cell polymorphisms in resistance and susceptibility to malaria. Clin Infect Dis 1999;28:794-799.
  • 10. Tekeste Z, Petros B. The ABO blood group and Plasmodium falciparum malaria in Awash, Metehara and Ziway areas, Ethiopia. Malar J 2010;9:280.
  • 11. Pathirana SL, Alles HK, Bandara S, Phone-Kyaw M, Perera MK, Wickremasinghe AR, Mendis KN, Handunnetti SM. ABO-blood-group types and protection against severe, Plasmodium falciparum malaria. Ann Trop Med Parasitol 2005;99:119-124.
  • 12. Rowe JA, Handel IG, Thera MA, Deans AM, Lyke KE, Koné A, Diallo DA, Raza A, Kai O, Marsh K, Plowe CV, Doumbo OK, Moulds JM. Blood group O protects against severe Plasmodium falciparum malaria through the mechanism of reduced rosetting. Proc Natl Acad Sci USA 2007;104:17471-17476.
  • 13. Panda AK, Panda SK, Sahu AN, Tripathy R, Ravindran B, Das BK. Association of ABO blood group with severe falciparum malaria in adults: case control study and meta-analysis. Malar J 2011;10:309.
  • 14. Rout R, Dhangadamajhi G, Ghadei M, Mohapatra BN, Kar SK, Ranjit M. Blood group phenotypes A and B are risk factors for cerebral malaria in Odisha, India. Trans R Soc Trop Med Hyg 2012;106:538-543.
  • 15. Resende SS, Milagres VG, Chaves DG, Fontes CJF, Carvalho LH, Sousa TN, Brito CFA. Increased susceptibility of blood type O individuals to develop anemia in Plasmodium vivax infection. Infect Genet Evol 2017;50:87-92.
  • 16. Vento S, Cainelli F, Cesario F. Infections and thalassaemia. Lancet Infect Dis 2006;6:226-233.
  • 17. Chotivanich K, Udomsangpetch R, Pattanapanyasat K, Chierakul W, Simpson J, Looareesuwan S, White N. Hemoglobin E: a balanced polymorphism protective against high parasitemias and thus severe P. falciparum malaria. Blood 2002;100:1172-1176.
  • 18. Wambua S, Mwangi TW, Kortok M, Uyoga SM, Macharia AW, Mwacharo JK, Weatherall DJ, Snow RW, Marsh K, Williams TN. The effect of alpha+-thalassaemia on the incidence of malaria and other diseases in children living on the coast of Kenya. PLoS Med 2006;3:643-651.
  • 19. Pasvol G, Weatherall DJ, Wilson RJ, Smith DH, Gilles HM. Fetal haemoglobin and malaria. Lancet 1976;1:1269-1272.
  • 20. Pantaleo A, Ferru E, Carta F, Valente E, Pippia P, Turrini F. Effect of heterozygous beta thalassemia on the phosphorylative response to Plasmodium falciparum infection. J Proteomics 2012;76:251-258.
  • 21. Walther M, De Caul A, Aka P, Njie M, Amambua-Ngwa A, Walther B, Predazzi IM, Cunnington A, Deininger S, Takem EN, Ebonyi A, Weis S, Walton R, Rowland-Jones S, Sirugo G, Williams SM, Conway DJ. HMOX1 gene promoter alleles and high HO-1 levels are associated with severe malaria in Gambian children. PLoS Pathog 2012;8:e1002579.
  • 22. Clark IA, Awburn MM, Harper CG, Liomba NG, Molyneux ME. Induction of HO-1 in tissue macrophages and monocytes in fatal falciparum malaria and sepsis. Malar J 2003;2:41.
  • 23. Sambo MR, Trovoada MJ, Benchimol C, Quinhentos V, Gonçalves L, Velosa R, Marques MI, Sepúlveda N, Clark TG, Mustafa S, Wagner O, Coutinho A, Penha-Gonçalves C. Transforming growth factor beta 2 and heme oxygenase 1 genes are risk factors for the cerebral malaria syndrome in Angolan children. PLoS One 2010;5:e11141.
  • 24. Shibahara S. The heme oxygenase dilemma in cellular homeostasis: new insights for the feedback regulation of heme catabolism. Tohoku J Exp Med 2003;200:167-186.
  • 25. Fucharoen S, Winichagoon P. Thalassemia and abnormal haemoglobin. Int J Hematol 2002;76(suppl):83-89.
  • 26. Nagel RL, Raventos-Suarez C, Febby ME, Tonowitz H, Sicard D, Labie D. Impairment of the growth of P. falciparum in HbEE erythrocytes. J Clin Invest 1981;68:303-305.
  • 27. World Health Organization. Haemoglobin Concentrations for the Diagnosis of Anaemia and Assessment of Severity. Geneva, Switzerland. World Health Organization; 2011.
  • 28. World Health Organization. Guidelines for the Treatment of Malaria. 2nd ed. Geneva, Switzerland. World Health Organization; 2010. p 35.
  • 29. Fu WP, Zhao ZH, Fang LZ, Sun C, Liu L, Zhang JQ, Zhang YP, Dai LM. Heme oxygenase-1 polymorphism associated with severity of chronic obstructive pulmonary disease. Chin Med J 2007;120:12-16.
  • 30. Chandanayingyong D, Sasaki TT, Greenwalt TJ. Blood groups of the Thais. Transfusion 1967;7:269-276.
  • 31. Nathalang O, Kuvanont S, Punyaprasiddhi P, Tasaniyanonda C, Sriphaisal T. A preliminary study of the distribution of blood group systems in Thai blood donors determined by the gel test. Southeast Asian J Trop Med Public Health 2001;32:204-207.
  • 32. Palacajornsuk P, Somsak P. Screening of ABO, Rh typing and unexpected alloantibodies in pregnant women attending antenatal care at Sriphat Medical Center, Faculty of Medicine, Chiang Mai University. J Assoc Med Sci 2017;50:153-158. (in Thai).
  • 33. Fucharoen S, Winichagoon P. Hemoglobinopathies in Southeast Asia. Hemoglobin 1987;11:65-88.
  • 34. Shibahara S, Kitamuro T, Takahashi K. Heme degradation and human disease: diversity is the soul of life. Antioxid Redox Signal 2002;4:593-602.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

The Effect of ABO Blood Groups, Hemoglobinopathy, and Heme Oxygenase-1 Polymorphisms on Malaria Susceptibility and Severity
Korean J Parasitol. 2018;56(2):167-173.   Published online April 30, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
The Effect of ABO Blood Groups, Hemoglobinopathy, and Heme Oxygenase-1 Polymorphisms on Malaria Susceptibility and Severity
Korean J Parasitol. 2018;56(2):167-173.   Published online April 30, 2018
Close
The Effect of ABO Blood Groups, Hemoglobinopathy, and Heme Oxygenase-1 Polymorphisms on Malaria Susceptibility and Severity
The Effect of ABO Blood Groups, Hemoglobinopathy, and Heme Oxygenase-1 Polymorphisms on Malaria Susceptibility and Severity

The distribution of ABO blood group and malaria species infected in 100 blood samples

Plasmodium species O (%) A (%) B (%) AB (%) Total (%)
Plasmodium falciparum 9 11 12 3 35
Plasmodium vivax 27 13 19 4 63
Mixed infections with P. falciparum and P. vivax 1 1 0 0 2
Total 37 25 31 7 100

The distribution of ABO blood group and risk of developing severe malaria based on parasitemia and the anemic status of patients (levels of hemoglobin and hematocrit)

Variables Distribution in ABO group

O A B AB
Parasitemia (median and range, /μl blood)
Plasmodium falciparum 15,776 (461–80,300) 7,200 (800–41,429) 9,703 (355–70,095) 1,608 (1,600–2,300)
Plasmodium vivax 4,705 (64–74,667) 3,909 (50–12,000) 2,583 (150–42,988) 12,075 (1,563–12,808)
 Mixed infections with P. falciparum and P. vivax 2,920 (2,920–2,920) 22,720 (22,720–22,720) - -

Hemoglobin (%)
 Non-anemia (male ≥13, female ≥12 g/dl) 14 13 15 4
 Mild anemia (male 11–12.9, female 11–11.9 g/dl) 13 8 8 0
 Moderate anemia (8.0–10.9 g/dl for both genders) 6 5 3 2
 Severe anemia (<8.0 g/dl for both genders) 4 0 5 0

Hematocrit (%)
 ≥20 37 26 28 6
 <20 0 0 3 0

Risk of developing severe malaria (%)
 Low risk 30 25 25 7
 High risk (parasitemia (≥70,000/μl) and/or hemo- globin (<8.0) and/or hematocrit <20% 7 0a 6 0

aStatistically significant difference from patients with other blood groups (P =0.026).

The prevalence of thalassemia in 100 malaria infected samples

Thalassemia No. (%) Malaria Type Hb (g/dL) Hct (%) MCV (fl) MCH (pg)

PF PV Mixed
Malaria with thalassemia 30 9 20 1 11.5 (5.1–14.3) 34.3 (15.9–44.1) 71.0 (53.0–91.0) 23.2 (15.2–30.2)
 Hb E 14 3 10 1 11.8 (7.8–14.3) 35.5 (21.9–43.0) 73.5 (63.0–83.0)b 24.1 (20.5–27.4)f
 β-thalassemia 1 1 0 0 6.0 (6.0–6.0) 18.0 (18.0–18.0) 58.0 (58.0–58.0) 18.7 (18.7–18.7)g
 α-thalassemia 1 1 1 0 0 12.7 (12.7–12.7) 41.3 (41.3–41.3) 68.7 (68.7–68.7) 21.2 (21.2–21.2)
 α-thalassemia 2 10 3 7 0 12.0 (5.1–14.3) 35.5 (15.9–44.1) 73.5 (53.0–91.0)c 23.8 (15.2–30.2)
 Hb E/α-thalassemia 2 1 0 1 0 7.6 (7.6–7.6) 24.0 (24.0–24.0) 62.0 (62.0–62.0) 19.7 (19.7–19.7)
 β/α-thalassemia 2 3 1 2 0 10.9 (9.8–11.1) 33.6 (28.3–34.3) 67.0 (60.0–67.0)d 21.3 (19.6–22.7)h

Malaria without thalassemia 70 26 43 1 12.4 (3.4–17.7) 37.7 (10.7–55.1)a 84.5 (50.0–101.0)e 27.80 (20.8–32.3)i

aStatistically significant difference from samples with thalassemia (P=0.006).

bStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.002).

cStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.045).

dStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.007).

eStatistically significant difference from samples with thalassemia (P<0.001).

fStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.001).

gStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.043).

hStatistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.006).

iStatistically significant difference from patients with thalassemia (P<0.001).

The association of thalassemia and anemic status in malaria infected samples

Thalassemia Anemic status

Non- anemia (%) Mild anemia (%) Moderate anemia (%) Severe anemia (%)
Malaria with thalassemiaa 10 7 7 6
 Hb E 6 2 4 2
 β-thalassemiab 0 0 0 1
 α-thalassemia 1 0 1 0 0
 α-thalassemia 2 4 3 1 2
 Hb E/α-thalassemia 2c 0 0 0 1
 β/α-thalassemia 2 0 1 2 0

Malaria without thalassemia 36 20 11 3d

aStatistically significant difference from patients with thalassemia (P=0.016).

bStatistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

cStatistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

dStatistically significant difference from patients with other types of thalassemia (P=0.019).

Distribution of HO-1 promoter genotypes (S and L) including allele (S/S, S/L, and L/L) frequencies and malaria severity in 100 malaria infected samples

Number Malaria species Malaria severity


P. falciparum P. vivax Mixed infection UM RSM
Alleles, n (%)
 S 112 (56)
 L 88 (44)

Genotypes, (%)
 S/S 25 8 16 1 22 3
 S/L 62 25 37 0 53 9
 L/L 13 2 10 1 12 1

UM, uncomplicated malaria; RSM, risk to severe malaria.

Table 1 The distribution of ABO blood group and malaria species infected in 100 blood samples
Table 2 The distribution of ABO blood group and risk of developing severe malaria based on parasitemia and the anemic status of patients (levels of hemoglobin and hematocrit)

Statistically significant difference from patients with other blood groups (P =0.026).

Table 3 The prevalence of thalassemia in 100 malaria infected samples

Statistically significant difference from samples with thalassemia (P=0.006).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.002).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.045).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.007).

Statistically significant difference from samples with thalassemia (P<0.001).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.001).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.043).

Statistically significant difference from samples with other types of thalassemia and without thalassemia (P=0.006).

Statistically significant difference from patients with thalassemia (P<0.001).

Table 4 The association of thalassemia and anemic status in malaria infected samples

Statistically significant difference from patients with thalassemia (P=0.016).

Statistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

Statistically significant difference from patients with other types of thalassemia and without thalassemia (P=0.023).

Statistically significant difference from patients with other types of thalassemia (P=0.019).

Table 5 Distribution of HO-1 promoter genotypes (S and L) including allele (S/S, S/L, and L/L) frequencies and malaria severity in 100 malaria infected samples

UM, uncomplicated malaria; RSM, risk to severe malaria.