Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Distribution Status of Hybrid Types in Large Liver Flukes, Fasciola Species (Digenea: Fasciolidae), from Ruminants and Humans in Vietnam

The Korean Journal of Parasitology 2018;56(5):453-461.
Published online: October 31, 2018

1Institute of Biotechnology (IBT), Vietnam Academy of Science and Technology (VAST) 18. Hoang Quoc Viet Rd, Cau Giay, Hanoi, Vietnam

2Hanoi Medical University, 1. Ton That Tung street, Dong Da, Hanoi, Vietnam

3Thai Nguyen University, Thai Nguyen, Vietnam

4Institute for Malariology, Parasitology and Entomology in Quy Nhon, Nguyen Thai Hoc, Quy Nhon, Vietnam

5Department of Environmental Medicine, Kochi Medical School, Kochi University, Oko, Nankoku City, Kochi, Japan

*Corresponding author (imibtvn@gmail.com)
• Received: September 2, 2018   • Revised: October 16, 2018   • Accepted: October 17, 2018

Copyright © 2018 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 13,024 Views
  • 201 Download
  • 25 Web of Science
  • 23 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Integrating hybridization and introgression into host–parasite epidemiology, ecology, and evolution
    Ben Lukubye, David J. Civitello
    Trends in Parasitology.2025; 41(2): 129.     CrossRef
  • Meta-analysis and systematic review of the prevalence and risk factors of animal fascioliasis in Eastern and Southern Africa between 2000 and 2023
    Stellah Nambuya, Chester Kalinda, Patrick Vudriko, Moses Adriko, Million Phiri, Tafadzwa Mindu, David Wagaba, Lawrence Mugisha
    Preventive Veterinary Medicine.2025; 239: 106490.     CrossRef
  • Challenges in the recognition of trematode species: Consideration of hypotheses in an inexact science
    T.H. Cribb, D.P. Barton, D. Blair, N.J. Bott, R.A. Bray, R.D. Corner, S.C. Cutmore, M.L.I. De Silva, B. Duong, A. Faltýnková, A. Gonchar, R.F. Hechinger, K.K. Herrmann, D.C. Huston, P.T.J. Johnson, G. Kremnev, R. Kuchta, C. Louvard, W.J. Luus-Powell, S.B.
    Journal of Helminthology.2025;[Epub]     CrossRef
  • Human fascioliasis emergence in southern Asia: Complete nuclear rDNA spacer and mtDNA gene sequences prove Indian patient infection related to fluke hybridization in northeastern India and Bangladesh
    M. Dolores Bargues, Patricio Artigas, George M. Varghese, T. Jacob John, Sitara S.R. Ajjampur, Syed Ali Ahasan, Emdadul Haque Chowdhury, Albis Francesco Gabrielli, Santiago Mas-Coma
    One Health.2024; 18: 100675.     CrossRef
  • Environmental influence on abundance and infection patterns of snail intermediate hosts of liver and intestinal flukes in North and Central Vietnam
    Phuong Thi Xuan Nguyen, Pierre Dorny, Hien Van Hoang, Bertrand Losson, Bernard Mignon, Dung Thi Bui
    Parasitology Research.2024;[Epub]     CrossRef
  • One Health monitoring reveals invasive freshwater snail species, new records, and undescribed parasite diversity in Zimbabwe
    Aspire Mudavanhu, Ruben Schols, Emilie Goossens, Tamuka Nhiwatiwa, Tawanda Manyangadze, Luc Brendonck, Tine Huyse
    Parasites & Vectors.2024;[Epub]     CrossRef
  • A multidisciplinary analysis of over 53,000 fascioliasis patients along the 1995–2019 countrywide spread in Vietnam defines a new epidemiological baseline for One Health approaches
    Nguyen Van De, Pham Ngoc Minh, Thanh Hoa Le, Do Trung Dung, Tran Thanh Duong, Bui Van Tuan, Le Thanh Dong, Nguyen Van Vinh Chau, Pablo F. Cuervo, M. Dolores Bargues, M. Adela Valero, Albis Francesco Gabrielli, Antonio Montresor, Santiago Mas-Coma
    One Health.2024; 19: 100869.     CrossRef
  • Fasciola hepatica and Fasciola hybrid form co-existence in yak from Tibet of China: application of rDNA internal transcribed spacer
    Wenqiang Tang, Yule Zhou, Leyi Li, Bin Shi, Xialing Zhao, Kai Li, Wenting Chui, Jun Kui, Fuqiang Huang
    Parasitology Research.2024;[Epub]     CrossRef
  • First morphometric and molecular characterization of Fasciola spp. in Northwest Tunisia
    Ines Hammami, Lavina Ciuca, Maria Paola Maurelli, Rihab Romdhane, Limam Sassi, Mohamed Ridha Rjeibi, Nadia Farhat, Alain Kouam Simo, Laura Rinaldi, Mourad Rekik, Mohamed Gharbi
    Parasitology Research.2023; 122(11): 2467.     CrossRef
  • One Health for fascioliasis control in human endemic areas
    Santiago Mas-Coma, M. Adela Valero, M. Dolores Bargues
    Trends in Parasitology.2023; 39(8): 650.     CrossRef
  • Wide variation of heterozygotic genotypes of recent fasciolid hybrids from livestock in Bangladesh assessed by rDNA internal transcribed spacer region sequencing and cloning
    Syed Ali Ahasan, Alejandra De Elías-Escribano, Patricio Artigas, Mohammad Zahangir Alam, M. Motahar Hussain Mondal, David Blair, Emdadul Haque Chowdhury, M. Dolores Bargues, Santiago Mas-Coma
    One Health.2023; 17: 100614.     CrossRef
  • Effects of temperature on the life history traits of intermediate host snails of fascioliasis: A systematic review
    Agrippa Dube, Chester Kalinda, Tawanda Manyangadze, Tafadzwa Mindu, Moses John Chimbari, María Victoria Periago
    PLOS Neglected Tropical Diseases.2023; 17(12): e0011812.     CrossRef
  • Human and animal fasciolosis: coprological survey in Narok, Baringo and Kisumu counties, Kenya
    Cornelius K. Kipyegen, Charles I. Muleke, Elick O. Otachi
    Onderstepoort Journal of Veterinary Research.2022;[Epub]     CrossRef
  • Identification of new polymorphic positions in rDNA sequences of the “intermediate” Fasciola forms
    Minhao Zeng, Xiaoxu Wang, Zhuo Lan, Xinru Guo, Yan Jiang, Tingting Wu, Qiaocheng Chang, Chunren Wang
    Parasitology International.2022; 88: 102555.     CrossRef
  • The causative agents of fascioliasis in animals and humans: Parthenogenetic Fasciola in Asia and other regions
    Tadashi Itagaki, Kei Hayashi, Yuma Ohari
    Infection, Genetics and Evolution.2022; 99: 105248.     CrossRef
  • Potential Hybridization of Fasciola hepatica and F. gigantica in Africa—A Scoping Review
    Sophy Nukeri, Mokgadi Pulane Malatji, Mita Eva Sengupta, Birgitte Jyding Vennervald, Anna-Sofie Stensgaard, Mamohale Chaisi, Samson Mukaratirwa
    Pathogens.2022; 11(11): 1303.     CrossRef
  • Human and Animal Fascioliasis: Origins and Worldwide Evolving Scenario
    Santiago Mas-Coma, M. Adela Valero, M. Dolores Bargues
    Clinical Microbiology Reviews.2022;[Epub]     CrossRef
  • New perspectives for fascioliasis in Upper Egypt’s new endemic region: Sociodemographic characteristics and phylogenetic analysis of Fasciola in humans, animals, and lymnaeid vectors
    Alzahraa Abdelraouf Ahmad, Haidi Karam-Allah Ramadan, Waleed Attia Hassan, Mohammed Ageeli Hakami, Enas Abdelhameed Mahmoud Huseein, Sara Abdel-Aal Mohamed, Adnan Ahmed Mohamed, Nahed Ahmed Elossily, Krystyna Cwiklinski
    PLOS Neglected Tropical Diseases.2022; 16(12): e0011000.     CrossRef
  • Morphological and molecular characterization of Fasciola hepatica and Fasciola gigantica phenotypes from co-endemic localities in Mpumalanga and KwaZulu-Natal provinces of South Africa
    Sayurika Haridwal, Mokgadi P. Malatji, Samson Mukaratirwa
    Food and Waterborne Parasitology.2021; 22: e00114.     CrossRef
  • Invasive snails, parasite spillback, and potential parasite spillover drive parasitic diseases of Hippopotamus amphibius in artificial lakes of Zimbabwe
    Ruben Schols, Hans Carolus, Cyril Hammoud, Kudzai C. Muzarabani, Maxwell Barson, Tine Huyse
    BMC Biology.2021;[Epub]     CrossRef
  • Description and phylogenetic analyses of ribosomal transcription units from species of Fasciolidae (Platyhelminthes: Digenea)
    T.H. Le, K.L.T. Pham, H.T.T. Doan, T.K. Xuyen Le, K.T. Nguyen, S.P. Lawton
    Journal of Helminthology.2020;[Epub]     CrossRef
  • Exposing the Barcoding Void: An Integrative Approach to Study Snail-Borne Parasites in a One Health Context
    Ruben Schols, Aspire Mudavanhu, Hans Carolus, Cyril Hammoud, Kudzai C. Muzarabani, Maxwell Barson, Tine Huyse
    Frontiers in Veterinary Science.2020;[Epub]     CrossRef
  • Identification of Adult Fasciola spp. Using Matrix-Assisted Laser/Desorption Ionization Time-of-Flight (MALDI-TOF) Mass Spectrometry
    Issa Sy, Lena Margardt, Emmanuel O. Ngbede, Mohammed I. Adah, Saheed T. Yusuf, Jennifer Keiser, Jacqueline Rehner, Jürg Utzinger, Sven Poppert, Sören L. Becker
    Microorganisms.2020; 9(1): 82.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Distribution Status of Hybrid Types in Large Liver Flukes, Fasciola Species (Digenea: Fasciolidae), from Ruminants and Humans in Vietnam
Korean J Parasitol. 2018;56(5):453-461.   Published online October 31, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Distribution Status of Hybrid Types in Large Liver Flukes, Fasciola Species (Digenea: Fasciolidae), from Ruminants and Humans in Vietnam
Korean J Parasitol. 2018;56(5):453-461.   Published online October 31, 2018
Close

Figure

  • 0
  • 1
Distribution Status of Hybrid Types in Large Liver Flukes, Fasciola Species (Digenea: Fasciolidae), from Ruminants and Humans in Vietnam
Image Image
Fig. 1 Representative adult individuals sorted out for groups of small (S), medium (M) and large (L) shaped Fasciola liver flukes based on morphological examination by their size and the inferred ratio (BL/BW) between the body length (BL) and body width (BW). Size is indicated by a bar (1.2 cm). (A) fresh; (B) preserved flukes.
Fig. 2 Phylogenetic tree showing topology of haplogroup relationships of Fasciola spp. from Vietnam and the reference isolates/strains from GenBank (Table 3) based on analysis of partial mitochondrial nad1 nucleotide sequence data (535 nucleotides) using Paragonimus westermani as an outgroup. Phylogenetic tree reconstruction was performed by MEGA 7.0 using a maximum likelihood (ML) analysis based on the general time-reversible model; supported for each node by 1,000 bootstrap resamplings [32]. In each sequence, species abbreviation is followed-up by strain and country (where the fluke was isolated). Names of haplogroups are included for reference (in brackets). Accession numbers are given at the end of each sequence. Basal node for F. gigantica is indicated by an arrow. Fasciola spp. sequences of this study from Vietnam are indicated by solid circles. Fsp: Fasciola species indicating intermediate forms (admixed/introgressive); number in bracket: identical nad1 sequences obtained in this study.
Distribution Status of Hybrid Types in Large Liver Flukes, Fasciola Species (Digenea: Fasciolidae), from Ruminants and Humans in Vietnam

No. of Fasciola samples collected from Northern and Central Provinces in Vietnam from ruminants and humans

Provinces Ruminants Humans
1 Cao Bang 95
2 Lang Son 121
3 Bac Kan 56
4 Yen Bai 98
5 Thai Nguyen 2,170
6 Ha Noi 772 6
7 Hung Yen 135
8 Hai Duong 88
9 Ninh Binh 218
10 Nghe An 94 1
11 Ha Tinh 66
12 Thua Thien-Hue 123 1
13 Quang Nam 36 1
14 Binh Dinh 125 3
15 Phu Yen 104
16 Khanh Hoa 188 1
17 Dak Lak 79
18 Ninh Thuan 157
19 Quang Binh 1
Total 4,725 14

Primer sequences used for amplification and sequencing internal transcribed spacers (ITS) and mitochondrial nad1 gene for molecular discrimination of Fasciola species

Genomic origin Regions/Genes used in this study Forward Reverse Length of amplicons (bp)


Name Sequence (5′ to 3′) Name Sequence (5′ to 3′)
Nuclear ribosomal transcription unit (rTU or rDNA) ITS1(421 bp) U18S2F TCGTGACTGGGATCGGGGC U3SR CGACCCTCGGACAGGCG 852
ITS1-5.8S-ITS2 U18S2F TCGTGACTGGGATCGGGGC U28S2R GACCTTGGAGTCGGGTTGT 1,519–1,520
ITS2 (361–362 bp) U3SF CGGTGGATCACTCGGCTCGTG U28S2R GACCTTGGAGTCGGGTTGT 811–812

Mitochondrial genome (mtDNA) *Partial nad1(535 bp) FANDF AGATGTGTGCTCTGCGAGC FANDR GAGTTGRCTGGCCGGTA 1,170

F, Forward; R, Reverse.

*A partial sequence (535 bp) of nad1 gene was used for haplogroup analysis.

List of nad1 reference sequences and their accession numbers from GenBank and published database used for phylogenetic analysis of F. gigantica haplogroups in the present study

Species Country/Accession number References and GenBank
Fasciola gigantica

Haplogroups*
 Haplogroup A Bangladesh (AB894370); India (LC012900; LC128314); Nepal (AB894337; AB894338); Myanmar (AB604022); [6,7,16,24,28,29,36,38]
GenBank
 Haplogroup B India (LC012897; LC012899); Myanmar (AB604007); Thailand (AB603724);
 Haplogroup C China (AB477364; AB477369); Indonesia (LC127274; LC127264); Vietnam (AB385616);
 Haplogroup D Egypt (LC076199; LC076204; AB554156; AB554167; AB554194);
 Haplogroup E Zambia (AB983823; AB983824; AB983832; AB983833; AB983835)
 Unclassified China (AB477368; AB604941; AB604939; AB604932); Myanmar (AB604020); Japan (AB207168); Korea (AB211240); Vietnam (MF430851; MF430852; MF430854; AB385619; AB536756; MF430855; MF287790; AB385617; MF430855); GenBank
Fasciola hepatica Australia (AF216697); China (AB477359); Egypt (AB554179); Ireland (AB207156); Peru (LC070666); Spain (KF111652); Uruguay (AB207154) [7,17,23,33,39]

Paragonimus westermani Korea (AF219379) GenBank

*Haplogroups suggested by Amer et al. [7].

No. of small (S), medium (M) and large (L) individual shapes based on morphological examination of flukes present in the Fasciola spp. population (n=4,725 adults) from ruminants

Physical examination No. Size (cm) Inferred ratio (BL/BW) %
S (Small) (n=284) 2.0–3.6×1.3 1.54–2.77/1 6
M (Medium) (n=614) 3.6–4.2×1.3 2.77–3.23/1 13
L (Large) (n=3,827) 4.2–6.5×1.2 3.23–5.4/1 81
Total (n=4,725) 100

BL, body length; BW, body width.

Molecular delineation of Fasciola species and types of hybridization among S-, M- and L-shaped liver flukes from ruminants and human samples in Vietnam based on the key nucleotide markers of ITS1 and ITS2 and mitochondrial nad1

ITS1 ITS2 rDNA status No. of liver flukes from ruminants mtDNA status (nad1) Delineation of Fasciola spp. in ruminants No. of samples from humans (%)



17 107 201 279 299* 327** L (n=40) (%) M (n=40) (%) S (n=40) (%)
T T T A T
RsaI(−)
- Fgig 40/(100) 31 (77.5) 0 Fgig F. gigantica (n=71) 9 (64.0)

C A C T C
RsaI(+)
T Fhep 0 6 (15.0) 36 (90.0) Fgig Introgressive Fasciola sp. (n=42) 3 (22.0)

Y W Y W Y
RsaI(+/−)
-/T Mixed (Fhep/Fgig) 0 3 (7.5) 4 (10.0) Fgig Admixed Fasciola sp. (n=7) 2 (14.0)

ITS1, ITS2, internal transcribed spacer 1 and 2; Fhep, F. hepatica; F. gigantica; rDNA, ribosomal DNA; mtDNA, mitochondrial DNA; S, small; M, medium, L, large shape; Y, T or C; W, T or A.

*299: F. hepatica possesses GTAC-sequence for a RsaI(+) at positions 296–299 in ITS1, while F. gigantica does not (GTAT/(RsaI(−));

**327: At position 327 in ITS2, a nucleotide T (Thymine) present in F. hepatica and absent in F. gigantica [11,21,37].

Table 1 No. of Fasciola samples collected from Northern and Central Provinces in Vietnam from ruminants and humans
Table 2 Primer sequences used for amplification and sequencing internal transcribed spacers (ITS) and mitochondrial nad1 gene for molecular discrimination of Fasciola species

F, Forward; R, Reverse.

A partial sequence (535 bp) of nad1 gene was used for haplogroup analysis.

Table 3 List of nad1 reference sequences and their accession numbers from GenBank and published database used for phylogenetic analysis of F. gigantica haplogroups in the present study

Haplogroups suggested by Amer et al. [7].

Table 4 No. of small (S), medium (M) and large (L) individual shapes based on morphological examination of flukes present in the Fasciola spp. population (n=4,725 adults) from ruminants

BL, body length; BW, body width.

Table 5 Molecular delineation of Fasciola species and types of hybridization among S-, M- and L-shaped liver flukes from ruminants and human samples in Vietnam based on the key nucleotide markers of ITS1 and ITS2 and mitochondrial nad1

ITS1, ITS2, internal transcribed spacer 1 and 2; Fhep, F. hepatica; F. gigantica; rDNA, ribosomal DNA; mtDNA, mitochondrial DNA; S, small; M, medium, L, large shape; Y, T or C; W, T or A.

299: F. hepatica possesses GTAC-sequence for a RsaI(+) at positions 296–299 in ITS1, while F. gigantica does not (GTAT/(RsaI(−));

327: At position 327 in ITS2, a nucleotide T (Thymine) present in F. hepatica and absent in F. gigantica [11,21,37].