Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea

The Korean Journal of Parasitology 2019;57(2):161-166.
Published online: April 30, 2019

1Viral and Rickettsial Diseases Department, Naval Medical Research Center, Silver Spring, MD 20910-7500, USA

2Department of Microbiology, Konkuk University School of Medicine, Seoul 05029, Korea

3Research Institute of Medical Science, Konkuk University School of Medicine, Seoul 05029, Korea

4Force Health Protection and Preventive Medicine, Medical Department Activity-Korea/65th Medical Brigade, Unit 15281, APO AP 96271-5281, USA

*Corresponding author (wjjang@kku.ac.kr)

These authors contributed equally to this work.

• Received: August 11, 2018   • Revised: December 4, 2018   • Accepted: December 23, 2018

Copyright © 2019 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 9,155 Views
  • 127 Download
  • 15 Web of Science
  • 13 Crossref
  • 16 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Projecting the potential distribution of Rickettsia japonica in China and Asian adjacent regions under climate change using the Maxent model
    Xiaoxu Wang, Meng Shang, Zihao Wang, Haoqiang Ji, Zhenxu Wang, Qiyong Liu
    Frontiers in Public Health.2025;[Epub]     CrossRef
  • Diversity and spread of cytoplasmic incompatibility genes among maternally inherited symbionts
    Julien Amoros, Marie Buysse, Anna Maria Floriano, Bouziane Moumen, Fabrice Vavre, Didier Bouchon, Olivier Duron, Seth Bordenstein
    PLOS Genetics.2025; 21(9): e1011856.     CrossRef
  • Molecular Identification of Spotted Fever Group Rickettsiae in Ticks in the Republic of Korea
    Ji-Ye Seo, Jin-Seo Park, Hee-Il Lee, Jung-Won Ju
    Pathogens.2024; 13(7): 575.     CrossRef
  • Molecular Detection of Anaplasma, Ehrlichia and Rickettsia Pathogens in Ticks Collected from Humans in the Republic of Korea, 2021
    Ji-Ye Seo, Yu-Jung Kim, Seong-Yoon Kim, Hee-Il Lee
    Pathogens.2023; 12(6): 802.     CrossRef
  • Spotted Fever Group Rickettsia Infecting Ticks (Acari: Ixodidae), Yak (Bos grunniens), and Tibetan Sheep (Ovis aries) in the Qinghai–Tibetan Plateau Area, China
    Yong-Cai He, Ji-Xu Li, Ya-Li Sun, Ming Kang, Hong-Xuan He, Yun-Hai Guo, Ping Ma, Yao-Ping Wei, Rui-Shan Li, Wang-Kai Chen, Zhi-Hong Chen, Jing Li, Tong-Sheng Qi, Jin-Fang Yang, Qing-Xun Zhang, Ye Wang, Jin-Shan Cai, Quan-Bang Zhao, Guang-Wei Hu, Ji-Yong C
    Frontiers in Veterinary Science.2022;[Epub]     CrossRef
  • Recent Progress on Tick-Borne Animal Diseases of Veterinary and Public Health Significance in China
    Weijuan Jia, Si Chen, Shanshan Chi, Yunjiang He, Linzhu Ren, Xueli Wang
    Viruses.2022; 14(2): 355.     CrossRef
  • Utility of ultra-rapid real-time PCR for detection and prevalence of Rickettsia spp. in ticks
    A-Tai Truong, Bo-Ram Yun, Mi-Sun Yoo, Jiyeon Lim, Subin Min, Soon-Seek Yoon, Young-Min Yun, Jong-Taek Kim, Yun Sang Cho
    BMC Veterinary Research.2022;[Epub]     CrossRef
  • Molecular detection of spotted fever group rickettsiae in hedgehogs (Erinaceus amurensis) and hedgehog-attached ticks in Xuyi County, Southeast China
    Changqiang Zhu, Lele Ai, Yong Qi, Yunsheng Liu, Hong Li, Fuqiang Ye, Qiuwei Wang, Yizhe Luo, Weilong Tan, Chunmeng Shi
    Experimental and Applied Acarology.2022; 88(1): 97.     CrossRef
  • Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China
    Li-Zhu Fang, Si-Cong Lei, Zhi-Jian Yan, Xiao Xiao, Jian-Wei Liu, Xiao-Qing Gong, Hao Yu, Xue-Jie Yu
    Pathogens.2021; 10(2): 115.     CrossRef
  • Geographic distribution and modeling of ticks in the Republic of Korea and the application of tick models towards understanding the distribution of associated pathogenic agents
    Heidi K. St. John, Penny Masuoka, Ju Jiang, Ratree Takhampunya, Terry A. Klein, Heung-Chul Kim, Sung-Tae Chong, Jin-Won Song, Yu-Jin Kim, Christina M. Farris, Allen L. Richards
    Ticks and Tick-borne Diseases.2021; 12(4): 101686.     CrossRef
  • Detection ofRickettsia lusitaniaeAmongOrnithodoros sawaiiSoft Ticks Collected From Japanese Murrelet Seabird Nest Material From Gugul Island, Republic of Korea
    Heung-Chul Kim, Ju Jiang, Jun Hang, Su Yeon Kim, Seok-Min Yun, Chang-uk Park, Miran Kim, Sung-Tae Chong, Christina M Farris, Allen L Richards, Terry A Klein, Kevin Macaluso
    Journal of Medical Entomology.2021; 58(3): 1376.     CrossRef
  • iSeq 100 for metagenomic pathogen screening in ticks
    Ju Yeong Kim, Myung-hee Yi, Alghurabi Areej Sabri Mahdi, Tai-Soon Yong
    Parasites & Vectors.2021;[Epub]     CrossRef
  • Identification and distribution of nine tick-borne spotted fever group Rickettsiae in the Country of Georgia
    Roena Sukhiashvili, Ekaterine Zhgenti, Ekaterine Khmaladze, Irma Burjanadze, Paata Imnadze, Ju Jiang, Heidi St. John, Christina M. Farris, Theresa Gallagher, Richard J. Obiso, Allen L. Richards
    Ticks and Tick-borne Diseases.2020; 11(5): 101470.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea
Korean J Parasitol. 2019;57(2):161-166.   Published online April 30, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea
Korean J Parasitol. 2019;57(2):161-166.   Published online April 30, 2019
Close

Figure

  • 0
  • 1
Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea
Image Image
Fig. 1 Map of the tick sampling sites. Ticks were collected in the northwestern (Incheon-si) and southwestern (Chungcheong-do, Jeolla-do) provinces of Korea.
Fig. 2 Phylogenic tree representing phylogenetic relationships between partial ompA sequence of various rickettsial strains and 625 bp of ompA product amplified from 30 selected DNA samples. The phylogenetic tree was constructed using MegAlign software and Bootstrap analysis was performed with 1,000 replicates.
Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea

Oligonucleotide primers used for detection of Rickettsia ompA, ompB and sca4

Target gene Primer Nucleotide sequence (5′→3 ′) Product size (bp) PCR condition (°C/sec)

Denaturation Annealing Extension Cycles
ompA 190-70Fb ATGGCGAATATTTCTCCAAAA 645 94 50 72 40
RompA642Ra,b ATTACCTATTGTTCCGTTAATGGCA 30 30 45
190-3588F AACAGTGAATGTAGGAGCAG 845 94 42 72 40
RompARm4433Ra,b,c GAATTTAAGGTTACTATACCTTC 30 30 50

ompB RompB11F ACCATAGTAGCMAGTTTTGCAG 1,892 94 50 72 40
RompB1902Ra CCGTCATTTCCAATAACTAACTC 30 30 120
RompBRm11Fc RCCATAGTRGCCAGTTKTGCAG 1,846 94 50 72 40
RompBRm1902Ra,c CCGTMATTTCCAATAACTAACTC 30 30 110

sca4 RrD928F ATTTATACACTTGCGGTAACAC 1,758 94 45 72 40
RrD2685Ra TTCAGTAGAAGATTTAGTACCAAAT 30 30 110
RrDRm1826Ra,c TCTAAATTCTGTTGCATCAAT

ompA, outer membrane protein A gene; ompB, outer membrane protein B gene, sca4, surface cell antigen gene.

aReverse orientation.

bPrimers for sequencing.

cSpecially designed primer for R. monacensis.

Summary on tick species, stage and 17-kDa positive nPCR collected from 3 projected regions

Province Species Stage No. of ticks (No. of tested pools) No. of 17-kDa PCR positive (%)
Incheon H. flava Larvaa 654 (24) 0 (0)
Nymphb 25 (6) 2 (8.0)
Adult (male)c 1 (1) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. longicornis Larvaa 1,080 (39) 23 (2.1)
Nymphb 12 (7) 4 (33.3)
Adult (male)c 6 (6) 3 (50.0)
Adult (female)c 3 (3) 1 (33.3)
I. nipponensis Larvaa 3 (1) 0 (0)
Nymphb 0 (0) 0 (0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Chungcheong-do H. flava Larvaa 127 (5) 0 (0)
Nymphb 74 (17) 4 (5.4)
Adult (male)c 2 (2) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. longicornis Larvaa 88 (3) 0 (0)
Nymphb 30 (7) 2 (6.7)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 1 (1) 0 (0)
I. nipponensis Larvaa 12 (1) 1 (8.3)
Nymphb 11 (4) 3 (27.2)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Jeolla-do A. testudinarium Larvaa 0 (0) 0 (0)
Nymphb 1 (1) 0 (0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. flava Larvaa 0 (0) 0 (0)
Nymphb 159 (36) 2 (1.2)
Adult (male)c 7 (7) 1 (14.3)
Adult (female)c 7 (7) 0 (0)
H. longicornis Larvaa 30 (2) 0 (0)
Nymphb 473 (98) 38 (8.0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 2 (2) 1 (50.0)
I. nipponensis Larvaa 0 (0) 0 (0)
Nymphb 6 (4) 3 (50.0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Total (%) 2,814 (284) 88 (3.1)

a1–39 larvae per pool,

b1–7 nymphs per pool,

c1 adults per pool.

Summary on nPCR results of ticks tested for 3 rickettsial target genes, ompA, ompB and sca4

Province Species No. of tested tick pools ompAa (%) ompBa (%) sca4a (%)
Northwestern
 Incheon H. flava 2 0 (0) 1 (50.0) 1 (50.0)
H. longicornis 31 20 (64.5) 11 (35.4) 15 (48.3)
I. nipponensis 0 0 (0) 0 (0) 0 (0)
Subtotal 33 20 (60.6) 12 (36.3) 16 (48.4)
H. flava 4 0 (0) 0 (0) 0 (0)

Southwestern
 Chungcheong-do H. longicornis 2 2 (100.0) 2 (100.0) 2 (100.0)
I. nipponensis 4 2 (50.0) 0 (0) 4 (100.0)
Subtotal 10 4 (40.0) 2 (20.0) 6 (60.0)
 Jeolla-do H. flava 3 3 (100.0) 0 (0) 0 (0)
H. longicornis 39 36 (92.3) 29 (74.3) 32 (82.1)
I. nipponensis 3 3 (100.0) 1 (33.3) 3 (100.0)
Subtotal 45 42 (93.3) 30 (66.6) 35 (77.7)

Total 88 66 (75.0) 44 (50.0) 57 (64.7)

aMFIR (Minimum field infection rate)=No. of positive pools/No. of tested tick in pools×100.

Table 1 Oligonucleotide primers used for detection of Rickettsia ompA, ompB and sca4

ompA, outer membrane protein A gene; ompB, outer membrane protein B gene, sca4, surface cell antigen gene.

Reverse orientation.

Primers for sequencing.

Specially designed primer for R. monacensis.

Table 2 Summary on tick species, stage and 17-kDa positive nPCR collected from 3 projected regions

1–39 larvae per pool,

1–7 nymphs per pool,

1 adults per pool.

Table 3 Summary on nPCR results of ticks tested for 3 rickettsial target genes, ompA, ompB and sca4

MFIR (Minimum field infection rate)=No. of positive pools/No. of tested tick in pools×100.