Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Transcriptomic Features of Echinococcus granulosus Protoscolex during the Encystation Process

The Korean Journal of Parasitology 2020;58(3):287-299.
Published online: June 26, 2020

1Department of Pathogenic Biology, Chongqing Medical University, Chongqing 400016, China

2Research Center for Molecular Medicine and Tumor, Chongqing Medical University, Chongqing 400016, China

3Chongqing No.18 Middle School, Chongqing 400016, China

*Corresponding author: (yebin@cqmu.edu.cn)
• Received: February 3, 2020   • Revised: April 1, 2020   • Accepted: April 7, 2020

Copyright © 2020 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,069 Views
  • 131 Download
  • 11 Web of Science
  • 12 Crossref
  • 15 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • The effects of E. granulosus protoscoleces proteins on host immune cells were elucidated through transcriptomic and metabolomic analyses
    Kalibixiati Aimulajiang, Xia Chen, Mayire Aizezi, Tanfang Zhou, Hao Wen
    Veterinary Parasitology.2026; 344: 110755.     CrossRef
  • First comparative proteomic and in vitro behavioral study of Echinococcus granulosus metacestodes in Felis catus
    Andrea Maglioco, Vanesa V. Miana, María Pía Valacco, Facundo A. Agüero, María Laura Gertiser, Héctor G. Avila, Melisa S. Barbery Venturi, Oscar Jensen, Alejandra Y. Juárez Valdez, Elio A. Prieto González, Alicia G. Fuchs
    Frontiers in Veterinary Science.2025;[Epub]     CrossRef
  • Genome-wide transcriptome analysis of Echinococcus multilocularis larvae and germinative cell cultures reveals genes involved in parasite stem cell function
    Michaela Herz, Magdalena Zarowiecki, Leonie Wessels, Katharina Pätzel, Ruth Herrmann, Christiane Braun, Nancy Holroyd, Thomas Huckvale, Monika Bergmann, Markus Spiliotis, Uriel Koziol, Matthew Berriman, Klaus Brehm
    Frontiers in Cellular and Infection Microbiology.2024;[Epub]     CrossRef
  • In vitro and in silico scolicidal effect of sanguinarine on the hydatid cyst protoscoleces
    Elham Hassanzadeh, Shahram Khademvatan, Behzad Jafari, Abbas Jafari, Elham Yousefi, Sheikh Arslan Sehgal
    PLOS ONE.2023; 18(10): e0290947.     CrossRef
  • Transcriptome analysis of Echinococcus granulosus sensu stricto protoscoleces reveals differences in immune modulation gene expression between cysts found in cattle and sheep
    Ismael Pereira, Christian Hidalgo, Caroll Stoore, María Soledad Baquedano, Carolina Cabezas, Macarena Bastías, Aníbal Riveros, Claudio Meneses, Martín Cancela, Henrique Bunselmeyer Ferreira, Leonardo Sáenz, Rodolfo Paredes
    Veterinary Research.2022;[Epub]     CrossRef
  • Chromosome-scale Echinococcus granulosus (genotype G1) genome reveals the Eg95 gene family and conservation of the EG95-vaccine molecule
    Pasi K. Korhonen, Liina Kinkar, Neil D. Young, Huimin Cai, Marshall W. Lightowlers, Charles Gauci, Abdul Jabbar, Bill C. H. Chang, Tao Wang, Andreas Hofmann, Anson V. Koehler, Junhua Li, Jiandong Li, Daxi Wang, Jiefang Yin, Huanming Yang, David J. Jenkins
    Communications Biology.2022;[Epub]     CrossRef
  • The Genomes of Two Strains of Taenia crassiceps the Animal Model for the Study of Human Cysticercosis
    Raúl J. Bobes, Karel Estrada, Diana G. Rios-Valencia, Arturo Calderón-Gallegos, Patricia de la Torre, Julio C. Carrero, Alejandro Sanchez-Flores, Juan P. Laclette
    Frontiers in Cellular and Infection Microbiology.2022;[Epub]     CrossRef
  • Evolutionary Adaptations of Parasitic Flatworms to Different Oxygen Tensions
    José de Jesús Martínez-González, Alberto Guevara-Flores, Irene Patricia del Arenal Mena
    Antioxidants.2022; 11(6): 1102.     CrossRef
  • Bioinformatics analysis and experimental verification of Notch signalling pathway-related miRNA–mRNA subnetwork in extracellular vesicles during Echinococcus granulosus encystation
    Jian Gao, Xuan Zhou, Ling Liu, Guodong Lv, Qiulian Hou, Xiaofan Zhang, Yujuan Shen
    Parasites & Vectors.2022;[Epub]     CrossRef
  • iTRAQ-based comparative proteomic analysis in different developmental stages ofEchinococcus granulosus
    Xin Li, Song Jiang, Xuhai Wang, Wenqiao Hui, Bin Jia
    Parasite.2021; 28: 15.     CrossRef
  • Genome-wide transcriptome analysis of the early developmental stages of Echinococcus granulosus protoscoleces reveals extensive alternative splicing events in the spliceosome pathway
    Mohammad Ali Mohammadi, Majid Fasihi Harandi, Donald P. McManus, Mehdi Mansouri
    Parasites & Vectors.2021;[Epub]     CrossRef
  • Synergism therapeutic and immunoregulatory effects of Albendazole + rAd-mIL-28B against Echinococcosis in experiment-infected mice with protoscoleces
    Yan Zhang, Jianghua Wang, Qingxia Yang, Zhi Li, Xiaoying Xu, Chong Chen, Zongjie Hou, Qi He, Li Sheng, Xingming Ma, Yanping Luo, Alessandra Morassutti
    PLOS Neglected Tropical Diseases.2021; 15(11): e0009927.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Transcriptomic Features of Echinococcus granulosus Protoscolex during the Encystation Process
Korean J Parasitol. 2020;58(3):287-299.   Published online June 26, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Transcriptomic Features of Echinococcus granulosus Protoscolex during the Encystation Process
Korean J Parasitol. 2020;58(3):287-299.   Published online June 26, 2020
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
Transcriptomic Features of Echinococcus granulosus Protoscolex during the Encystation Process
Image Image Image Image Image Image
Fig. 1 Protoscoleces were cultured in vitro at different developmental stages. (A) Day 0 of culture. (B) Complete gestation was observed on day 10. (C) Day 20 of culture. (D) Day 40 of culture. (E) On day 80 of culture. Lower panel: agarose gel electrophoresis images with total RNA extracted from the protoscoleces, corresponding to each stage in the upper panel.
Fig. 2 Venn diagrams showing differentially expressed genes among the experimental groups. Circles of different colors represent a set of (A) genes and (B) transcripts expressed in a sample, where the values represent the number of common and uniquely expressed genes/transcripts between a 2-or3-group sample. The sum of all numbers inside the circle represents the group. The sum of the number of expressed genes, the cross-region of the circle, represents the number of shared genes of each group of expressed genes/transcripts.
Fig. 3 Transcription profiles of significantly differentially expressed genes. Venn diagram showing significantly (A) up-regulated DEGs and (B) down-regulated DEGs. (C) Hierarchical clustering map of 52 up-regulated DEGs showing overall TPM. log10 (TPM+1) values that are scaled and clustered. Red denotes up-regulated genes and blue denotes down-regulated genes. The upper clamps are sample clusters. The closer two sample branches are, the closer expression pattern of all genes in the two samples. (D) Correlation among 52 up-regulated DEGs. A node represents a gene. Lines between nodes represent a correlation between the levels of gene expression. The larger a node, the more a gene is correlated with other genes.
Fig. 4 Gene ontology (GO) transcript classification. The broken line corresponds to genes at the different culture periods. The column indicates the enrichment level. The smaller the FDR −log10 (FDR) value, the more significant the GO term.
Fig. 5 Vasopressin-regulated water reabsorption. Products with a colored background belong to the KEGG annotation results of this sequencing. A yellow background denotes the reference gene, and the red border indicates that the genes in the analyzed gene set are annotated.
Fig. 6 Verification of up-regulated (A) and down-regulated DEGs (B) by Qrt-PCR. Reference was actin II transcript. *P<0.01, **P<0.001, ***were considered extremely significant.
Transcriptomic Features of Echinococcus granulosus Protoscolex during the Encystation Process

Primers used in Qrt-PCR

Gene name Annotation in gene database Forward (FP) and reverse primers (RP) Product size (bp)
Up-regulated DEGs
 EGR_03608 Cornifelin FP: AGTCTGCTTCCATTGACGACCA 149
RP: CCATCGCTGTCGCCTTCGGTA
 EGR_00384 Thioredoxin-related transmembrane protein FP: TGCAAATGTACGCTACTACCC 88
RP: ACGTAAAGTAGGCTCAAGCAA
 EGR_01086 Vesicle transport through interaction with t-SNAREs 1A FP: AGATAGCAGCAACTACCCGTTT 91
RP: TTCACATCAGCAGGCATGTCC
 EGR_06269 Minor histocompatibility H13 FP: TATTACCGTTTTCCGTCGAGA 96
RP: GCGGCAAATATCTTAAACACC
 EGR_09743 Collagen, type XV, alpha FP: AAAGGACTCTACTGGACCTCG 84
RP: GAAGTCCACTGATCGCACGTT
 EGR_08242 Signal transducing adapter molecule FP: TGATGCCCAAAATGCTACACC 140
RP: CGAAATCGAATAGAGCACGAAC

Down-regulated DEGs
 EGR_10426 Transcription elongation factor FP: TGATTGAGCCACTACCGAAGCA 123
RP: AGTCCTCCAGGCATATTCCAC
 EGR_08627 Fatty acid-binding protein FP: AAACCCGTGCTTACCTTCG 145
RP: CATCCGTGGTGTTCTCATCG
 EGR_09751 heat shock protein FP: TCCAGGCCGTATTACTGAGCA 96
RP: ATGACTTTAGTGCCACCGT
 EGR_09229 LIM and SH3 domain protein FP: GCCAGTGTGACGTAGTCCTC 107
RP: CGTTTGTGTGTTCTTCGCCAA
 EGR_00894 Hypothetical protein FP: AGTCAATTCAAGTAATCGTGCTG 80
RP: TTCTCGCTTGATTTTCGCCACT
 EGR_03601 BoIA-like protein 3 FP: TTCTTAATGTCTGCCGCCAT 104
RP: AGTAGAGCCTCCTTATAGTCC

Control primer
 EGR_09068 Actin II FP: ATGGTTGGTATGGGACAAAAGG 118
RP: TTCGTCACAATACCGTGCTC

Sequencing data statistics

Sample Raw reads Raw bases Clean reads Clean bases Error rate; (%) Q20 (%) Q30 (%) GC content (%)
EgPSC_0d_1 60,847,206 9,187,928,106 60,032,580 8,950,587,025 0.0274 97.19 91.78 47.07
EgPSC_0d_2 65,486,882 9,888,519,182 64,718,518 9,648,903,196 0.0267 97.47 92.42 47.43
EgPSC_0d_3 44,838,914 6,725,837,100 44,709,544 6,679,256,433 0.0120 98.31 95.24 46.25
EgPSC_10d_1 50,879,460 7,682,798,460 49,912,092 7,433,785,290 0.0232 98.79 95.88 41.48
EgPSC_10d_2 45,451,476 6,863,172,876 44,642,728 6,648,774,193 0.0234 98.73 95.67 43.67
EgPSC_10d_3 51,627,418 7,795,740,118 50,541,444 7,440,873,654 0.0234 98.72 95.73 45.10
EgPSC_20d_1 62,302,076 9,407,613,476 46,103,180 6,618,060,319 0.0231 98.78 96.06 48.29
EgPSC_20d_2 56,237,888 8,491,921,088 45,097,156 6,377,338,828 0.0232 98.76 96.02 48.01
EgPSC_20d_3 54,920,334 8,292,970,434 52,009,700 7,464,895,752 0.0233 98.77 95.88 45.28
EgPSC_40d_1 59,219,662 8,942,168,962 58,640,210 8,770,998,130 0.0235 98.66 95.60 47.32
EgPSC_40d_2 52,049,106 7,859,415,006 51,576,654 7,738,872,659 0.0237 98.61 95.46 48.24
EgPSC_40d_3 54,113,540 8,171,144,540 53,665,904 8,042,017,580 0.0238 98.58 95.35 47.31
EgPSC_80d_1 49,360,298 7,453,404,998 48,784,352 7,308,163,088 0.0239 98.52 95.23 47.27
EgPSC_80d_2 49,876,008 7,531,277,208 49,296,316 7,387,535,278 0.0240 98.49 95.13 46.91
EgPSC_80d_3 50,275,646 7,591,622,546 49,770,288 7,457,638,729 0.0241 98.45 95.03 46.99
Average 53,832,394 8,125,702,273 51,300,044 7,597,846,677 0.0232 98.46 95.09 46.44

COG classification of the consistently up-regulated differentially expressed genes

Category Function Gene description
Information storage and processing RNA processing and modification Transcription elongation regulator
Potassium voltage-gated channel subfamily C member 3
Metabolism Amino acid transport and metabolism Ornithine aminotransferase
Information storage and processing Translation, ribosomal structure and biogenesis Epsin-1
NEDD8-conjugating enzyme UBE2F
Poorly characterized Function unknown Synaptic vesicle membrane protein VAT-1-like protein
WD repeat-containing protein
5′-tyrosyl-DNA phosphodiesterase
Josephin-2
Cornifelin
Glycosyltransferase-like protein LARGE2
1,5-anhydro-D-fructose reductase
Cellular processes and signaling Intracellular trafficking, secretion, and vesicular transport Platelet glycoprotein
Table 1 Primers used in Qrt-PCR
Table 2 Sequencing data statistics
Table 3 COG classification of the consistently up-regulated differentially expressed genes