Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Ampicillin treated German cockroach extract leads to reduced inflammation in human lung cells and a mouse model of Asthma

Parasites, Hosts and Diseases 2023;61(1):60-71.
Published online: February 22, 2023

Department of Environmental Medical Biology, Institute of Tropical Medicine and Arthropods of Medical Importance Resource Bank, Yonsei University College of Medicine, Seoul 03722, Korea

*Correspondence: (JYKIM0802@yuhs.ac)
• Received: October 27, 2022   • Accepted: February 9, 2023

© 2023 The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 4,858 Views
  • 163 Download
  • 4 Web of Science
  • 4 Crossref
  • 4 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Asthma research in mice: An overview of current models and their methodological variability
    Yan-Jiao Chen, Cai-Tao Chen, Gabriel Shimizu Bassi, Yong-Qing Yang
    International Reviews of Immunology.2025; 44(3): 127.     CrossRef
  • Invasive indoor pests under the microbiological lens: bacterial and viral diversity from local to global scales in bed bugs and cockroaches
    Jose E Pietri, Maureen Laroche
    Current Opinion in Insect Science.2025; 69: 101344.     CrossRef
  • Multi-omics of cockroaches infected with Salmonella Typhimurium identifies molecular signatures of vector colonization
    Diing DM Agany, Eduardo A. Callegari, Maria D. Paez, Jose E. Pietri
    BMC Genomics.2025;[Epub]     CrossRef
  • Microbiome of laboratory‐reared and environmentally collected cockroaches
    Sohyeon Yun, Jun Ho Choi, Singeun Oh, Myungjun Kim, Myung‐hee Yi, Dongjun Kang, Yun Soo Jang, In‐Yong Lee, Tai‐Soon Yong, Juan Kim, Heung Chul Kim, Jae Rok Lee, Ju Yeong Kim
    Entomological Research.2024;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Ampicillin treated German cockroach extract leads to reduced inflammation in human lung cells and a mouse model of Asthma
Parasites Hosts Dis. 2023;61(1):60-71.   Published online February 22, 2023
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Ampicillin treated German cockroach extract leads to reduced inflammation in human lung cells and a mouse model of Asthma
Parasites Hosts Dis. 2023;61(1):60-71.   Published online February 22, 2023
Close

Figure

  • 0
  • 1
  • 2
Ampicillin treated German cockroach extract leads to reduced inflammation in human lung cells and a mouse model of Asthma
Image Image Image
Fig. 1 Total bacteria and major allergens of German cockroaches treated with ampicillin. (A) Experimental design depicting ampicillin treatment in B. germanica. The cockroaches were divided into 2 groups, and individuals were either treated with ampicillin (ampicillin group: A) or left untreated as control specimens (control group: C). Ampicillin was administered to cockroaches from the G1 (i.e., offspring from G0) generation, 21 days after they reached the adult stage. (B) Relative levels of bacterial 16S rRNA genes in the control group and ampicillin group. (C) Concentration of lipopolysaccharides (LPS) in 1 mg/ml of B. germanica extract. (D) Quantitative PCR (qPCR) analysis showing Bla g1, Bla g2, and Bla g5 gene expression levels in German cockroaches. (E) Allergen levels in extracts from the 2 German cockroach groups. *P<0.05, **P<0.01, ***P<0.001.
Fig. 2 Effect of exposure to extracts of antibiotic-treated cockroaches on cytokine expression in bronchial epithelium in vitro. Concentrations of (A) IL-6 and (B) IL-8 secreted from human bronchial epithelial cells (BEAS-2B) exposed to the extract of German cockroaches treated with 0.03% ampicillin (ampicillin group). ***P<0.001.
Fig. 3 Effect of exposure to extracts of antibiotic-treated cockroaches in a mouse model of asthma. (A) Number of total cells, macrophages, eosinophils, neutrophils, and lymphocytes in the bronchoalveolar lavage (BAL) fluid of asthma model mice. (B–D) Lung histology results in the mouse model of allergic airway inflammation. (B) Histologic results with hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) staining of lung tissues. (C, D) Immune cell infiltration scores and inflammation scores including mucus production scores. Data are reported as mean±SE (n=8/group). (E, F) Supernatants of BAL fluid were collected after centrifugation, and the production of IL-4, IL-5, IL-13, and IFN-γ was measured. Concentrations of IL-4, IL-5, IL-13, and IFN-γ in lung tissues were analyzed using the respective ELISA kits. Comparison of serum B. germanica-specific (G) IgE, (H) IgG1, and (I) IgG2a levels among B. germanica-induced asthmatic mice groups. Optical density values measured during ELISA are also presented. Data are reported as mean±SE (n=8/group). One-way ANOVA was conducted, and the Bonferroni-corrected p-values are presented. PBS group: PBS-treated group; Control group: group exposed to normal German cockroach extract; Ampicillin group: group exposed to ampicillin-treated German cockroach extract. *P<0.05, **P<0.01, ***P<0.001.
Ampicillin treated German cockroach extract leads to reduced inflammation in human lung cells and a mouse model of Asthma

Primers used in this study

Primer name Primer sequence (5′ → 3′)
ActinF CACATACAACTCCATTATGAAGTGCGA
ActinR TGTCGGCAATTCCGGTACATG
BACT1369 CGGTGAATACGTTCYCGG
PROK1492R GGWTACCTTGTTACGACTT
Blag1F CTATATGACGCCATCCGTTCTC
Blag1R CACATCAACTCCCTTGTCCTT
Blag2F TGATGGGAATGTACAGGTGAAA
Blag2R TGTTGAGATGTCGTGAGGTTAG
Blag5F GATTGATGGGAAGCAAACACAC
Blag5R CGATCTCCAAGTTCTCCCAATC
Table 1 Primers used in this study