Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Detection of Plasmodium vivax by Nested PCR and Real-Time PCR

The Korean Journal of Parasitology 2010;48(2):99-103.
Published online: June 17, 2010

1Adiyaman University, Vocational School of Health Services, Adiyaman, Turkey.

2Cukurova University, Faculty of Medicine, Department of Parasitology, Adana, Turkey.

Corresponding author (agenc@adiyaman.edu.tr)
• Received: January 5, 2010   • Revised: March 8, 2010   • Accepted: March 17, 2010

Copyright © 2010 by The Korean Society for Parasitology

  • 10,170 Views
  • 105 Download
  • 13 Crossref
  • 17 Scopus
next

Citations

Citations to this article as recorded by  Crossref logo
  • Optimization of the real-time PCR platform method using high-resolution melting analysis and comparison with sequencing and phylogenetic analysis for developing optimal malaria diagnostic methods
    Omid Ahmadi, Yousef Sharifi, Michael Saeed, Amirali Reihani, Seyed Aliakbar Shamsian, Elham Moghaddas, Hadi Mirahmadi, Soudabeh Etemadi, Reza Fotouhi-Ardakani, Mehdi Zarean
    Scientific Reports.2025;[Epub]     CrossRef
  • Isolation and identification of mosquito-borne zoonotic diseases in slaughterhouse in Daejeon
    Youngju Kim, Gyurae Kim, Sunkyong Song, Youngshik Jung, Seojin Park, Sang-Joon Lee, Ho-Seong Cho, Yeonsu Oh
    Korean Journal of Veterinary Service.2023; 46(2): 115.     CrossRef
  • Non-Human Primate Malaria Infections: A Review on the Epidemiology in Malaysia
    Nor Diyana Dian, Mohd Amirul Fitri A. Rahim, Sherwin Chan, Zulkarnain Md Idris
    International Journal of Environmental Research and Public Health.2022; 19(13): 7888.     CrossRef
  • A Review on PCR and POC-PCR - A Boon in the Diagnosis of COVID-19
    Singaravelan Sindhuja, Sivaperuman Amuthalakshmi, Calambur Nagarajan Nalini
    Current Pharmaceutical Analysis.2022; 18(8): 745.     CrossRef
  • Considerations on PCR-based methods for malaria diagnosis in China malaria diagnosis reference laboratory network
    Jianhai Yin, Mei Li, He Yan, Shuisen Zhou
    BioScience Trends.2018; 12(5): 510.     CrossRef
  • Molecular malaria diagnostics: A systematic review and meta-analysis
    Johanna M. Roth, Daniël A. Korevaar, Mariska M. G. Leeflang, Pètra F. Mens
    Critical Reviews in Clinical Laboratory Sciences.2016; 53(2): 87.     CrossRef
  • Sparse serological evidence of Plasmodium vivax transmission in the Ouest and Sud-Est departments of Haiti
    Thomas A. Weppelmann, Michael E. von Fricken, Brandon Lam, Taina Telisma, Alexandre Existe, Jean F. Lemoine, Joseph Larkin, Bernard A. Okech
    Acta Tropica.2016; 162: 27.     CrossRef
  • Detection of Mixed-Species Infections of Plasmodium falciparum and Plasmodium vivax by Nested PCR and Rapid Diagnostic Tests in Southeastern Iran
    Hossein Keshavarz, Ahmad Raeisi, Aliehsan Heidari, Asghar Fazaeli, Reyhaneh Ehtesham
    The American Journal of Tropical Medicine and Hygiene.2015; 93(1): 181.     CrossRef
  • Increased detection of Plasmodium knowlesi in Sandakan division, Sabah as revealed by PlasmoNex™
    Xiang Ting Goh, Yvonne AL Lim, Indra Vythilingam, Ching Hoong Chew, Ping Chin Lee, Romano Ngui, Tian Chye Tan, Nan Jiun Yap, Veeranoot Nissapatorn, Kek Heng Chua
    Malaria Journal.2013;[Epub]     CrossRef
  • Plasmodium-Specific Molecular Assays Produce Uninterpretable Results and Non-Plasmodium spp. Sequences in Field-Collected Anopheles Vectors
    Genelle F. Harrison, Desmond H. Foley, Leopoldo M. Rueda, Vanessa R. Melanson, Richard C. Wilkerson, Lewis S. Long, Jason H. Richardson, Terry A. Klein, Heung-Chul Kim, Won-Ja Lee
    The American Journal of Tropical Medicine and Hygiene.2013; 89(6): 1117.     CrossRef
  • Correlates of HIV and malaria co-infection in Southern India
    Ajay R Bharti, Shanmugam Saravanan, Vidya Madhavan, Davey M Smith, Jabin Sharma, Pachamuthu Balakrishnan, Scott L Letendre, Nagalingeswaran Kumarasamy
    Malaria Journal.2012;[Epub]     CrossRef
  • Molecular diagnosis of infections and resistance in veterinary and human parasites
    Peter W. Hunt
    Veterinary Parasitology.2011; 180(1-2): 12.     CrossRef
  • Incidence of Malaria in the Interior Division of Sabah, Malaysian Borneo, Based on Nested PCR
    Wan Fen Joveen-Neoh, Ka Lung Chong, Clemente Michael Vui Ling Wong, Tiek Ying Lau
    Journal of Parasitology Research.2011; 2011: 1.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Detection of Plasmodium vivax by Nested PCR and Real-Time PCR
Korean J Parasitol. 2010;48(2):99-103.
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Detection of Plasmodium vivax by Nested PCR and Real-Time PCR
Korean J Parasitol. 2010;48(2):99-103.
Close

Figure

  • 0
  • 1
  • 2
Detection of Plasmodium vivax by Nested PCR and Real-Time PCR
Image Image Image
Fig. 1 Results of genus-specific nested-PCR. Lane 1, 100-3,000 bp DNA lader; Lanes 2-4, Plasmodium spp. isolates.
Fig. 2 Results of species-specific nested-PCR. Lane 1, 100-3,000 bp DNA lader; Lanes 2-4, P. vivax isolates.
Fig. 3 Results of species-specific real-time PCR.
Detection of Plasmodium vivax by Nested PCR and Real-Time PCR
Species Kind of PCR Primer Sequence (5′-3′) PCR product Plasmodium sp. nested (genus-specific) rPLU5 CTTGTTGTTGCCTTAAACTTC 1,200 bp rPLU6 TTAAAATTGTTGCAGTTAAAACG P. vivax nested (species-specific) rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 120 bp rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA P. vivax real-Time (species-specific) VIV-F ACGCTTCTAGCTTAATCCACATAACT 141 bp VIV-R ATTTACTCAAAGTAACAAGGACTTCCAAGC VIV Probe TTCGTATCGACTTTGTGCGCATTTTGC Assay Positive Negative % of Positive % of Negative %Sensitivity %Specificity ME of thick blood films 44 48 47.8 52.2 - - Nested PCR 52 40 56.5 43.5 97.7 81.2 Real-time PCR 56 36 60.9 39.1 100 75
Table 1. Primers and probe for 18S rRNA gene in P. vivax
Table 2. Results of nested PCR and real-time PCR according to microscopic examination of thick blood films

ME, Microscopic examination.