Warning: fopen(/home/virtual/parasitol/journal/upload/ip_log/ip_log_2025-12.txt): failed to open stream: Permission denied in /home/virtual/lib/view_data.php on line 83

Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 84
Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai
Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai

The Korean Journal of Parasitology 2004;42(3):129-135.
Published online: September 20, 2004

1Department of Parasitology, College of Medicine, Hallym University, Chuncheon 200-702, Korea.

2Department of Parasitology, Institute of Health Sciences, Gyeongsang National University College of Medicine, Jinju 660-751, Korea.

3Department of Parasitology and Tropical Medicine, Seoul National University College of Medicine, Seoul 110-799, Korea.

Corresponding author (shuh@hallym.ac.kr)
• Received: March 18, 2004   • Accepted: June 16, 2004

Copyright © 2004 by The Korean Society for Parasitology

  • 10,956 Views
  • 110 Download
  • 20 Crossref
  • 30 Scopus
prev next
  • We compared the DNA sequences of the genus Metagonimus: M. yokogawai, M. takahashii, and M. miyatai. We obtained 28S D1 ribosomal DNA (rDNA) and mitochondrial cytochrome c oxidase subunit I (mtCOI) fragments from the adult worms by PCR, that were cloned and sequenced. Phylogenetic relationships inferred from the nucleotide sequences of the 28S D1 rDNA and mtCOI gene. M. takahashii and M. yokogawai are placed in the same clade supported by DNA sequence and phylogenic tree analysis in 28S D1 rDNA and mtCOI gene region. The above findings tell us that M. takahashii is closer to M. yokogawai than to M. miyatai genetically. This phylogenetic data also support the nomination of M. miyatai as a separate species.
Metagonimiasis is an endemic intestinal trematode infection in Korea with 0.3% egg positives in the general population, i.e. 130,000 infected people (Ministry of Health and Social Welfare, and Korea Association of Health, 1997). Human infection with the three Metagonimus (Digenea: Heterophyidae) species is due to eating of raw fishes (intermediate hosts), and is regarded as a parasitic disease of importance to public health in the riverside areas of the southern and eastern coasts of Korea (Yu et al., 1994; Chai et al., 2000b; Lee et al., 2002). Three species of the genus Metagonimus are known in Korea (Chai et al., 1991): M. yokogawai (Katsurada, 1912), M. takahashii (Suzuki, 1930), and M. miyatai (Miyata, 1941, 1944; Saito et al., 1984, 1997). These three species are differentiated by their morphology (Chai et al., 1991, 1998, 2000a), as they have different fish species as hosts (Rim et al., 1996), different geographical distributions (Kim et al., 1987; Chai et al., 1993; Yu et al., 1994; Lee et al., 2002). In addition, they have different polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) patterns and random amplified polymorphic DNA (RAPD) patterns (Yu et al., 1997a, 1997b), and simple sequence repeat anchored polymerase chain reaction (SSR-PCR) patterns of genomic DNA of ribosomal RNA and mitochondrial cytochrome c oxidase 1 (mtCOI) gene (Yang et al., 2000). However, few studies have been conducted on the DNA sequences of Metagonimus spp. In the present study, we compared the 28S D1 rDNA and mtCOI gene sequences of the three species of Metagonimus distributed in the Republic of Korea, to determine their molecular phylogenies.
Genomic DNA purification from worms
The adult specimens of M. takahashii, M. miyatai and M. yokogawai species were obtained 7 days post-infection from rats (Sprague-Dawley, 4 to 6-wk-old). Metacercariae of each species were collected from Korean freshwater fishes, Carassius auratus, Zacco platypus, and Plecoglossus altivelis, respectively (Saito et al., 1997; Yu et al., 1997b). Two adult trematodes of family Heterophyidae, Pygidiopsis summa and Stellantchasmus falcatus obtained from experimentally infected animals were included and S. falcatus was used as an outgroup to infer phylogeny. Adult worms were stored at -70℃ until used. DNA was extracted using the phenol/chloroform method and precipitated in ethanol, as reported by Sambrook and Russell (2001).
28S D1 rDNA and mtCOI PCR
PCR was conducted using a mixed solution of extracted DNA as a template (0.01 µg/µl), primer, and ExTaq enzyme (TaKaRa Ex Taq Kit, TAKARA Shuzo Co., LTD. Japan) in a GeneAmp PCR System 9600 (Perkin Elmer, USA). The PCR reaction cycle consisted of 40 cycles of denaturation at 95℃ for 20 seconds, annealing at 55℃ for 30 seconds and extension at 72℃ for 30 seconds followed by a final extension of 6 minutes. The forward primer (JB10, 5' GATTACCCGCTGAACTTAAGCATA 3') consisted of the conserved region from the 21st-45th base pairs of 28S rDNA sequence of mouse. The reverse primer (JB9, 5' GCTGCATTCACAAACACCCCGACTC 3') was obtained from the 278th-302nd base pairs of the same gene (Hassounna et al., 1984; Qu et al., 1988; Bowles and McManus, 1994). The PCR of mtCOI were performed using the above described method, but with different primers. The forward primer was JB3 (5' TTTTTTGGGCATCCTGAGGTTTAT 3') (2575), and the reverse primer was JB4.5 (5' TAAAGAAAGAACATAATGAAAATG 3') (3021). The numbers in brackets refer to the position of the 5' end of the primer from the nucleotide sequences of Fasciola hepatica (Bowles and McManus, 1994). The PCR condition used was the same as that described above, except for that annealing was done at 48℃ for 30 seconds.
Cloning and sequencing of 28S D1 rDNA and mtCOI
The PCR products amplified with the primer sets were purified by gel extraction (QIAEX DNA Gel extraction Kit, QIAGEN Co., Germany) and were subcloned into the EcoRV site of a pT7Blue T-vector Kit plus ligase (Novagen Co., USA), according to the protocol from the supplier. For transformation, NovaBlue competent cells were used as a host cell (Novagen Co., WI, USA). The recombinant plasmid was screened using isopropyl-β-thiogalactoside (IPTG) and 5-bromo-4 chloro-3-indolyl-β-D-galactoside (X-gal). The cloned fragments in the recombinant plasmids were digested with BamHI and HindIII enzyme and purified from agarose gel using a QIAprep spin plasmid kit (QIAGEN Co.). DNA sequencing was performed by dideoxy chain termination method (Sanger et al., 1977) using a Sequenase kit (ABI prism dye terminator cycle sequencing core kit, Perkin Elmer) and an automated DNA sequencer (Applied Biosystems model 373A, Perkin Elmer) on both strands with T3 and T7 primers. At least three clones were sequenced per sample with additional clones sequenced as necessary to resolve ambiguous sites.
Sequence analysis and alignment
For the analysis of DNA sequences, NCBI (National Center for Biotechnology Information) databases were used for homology analysis (BLAST2). We also calculated the fractional GC content of nucleic acid sequences using an EMBOSS GEECEE program in Sanger Institute, Cambridge, U.K. (http://analysis.molbiol.ox.ac.uk/pise_html/geecee.html). All obtained sequences were aligned automatically using CLUSTAL W program (version 1.82, CLUSTAL W WWW Service at the European Bioinformatics Institute, http://www.ebi.ac.uk/clustalw) for multiple sequence alignments while alignment gaps were treated as missing data (Higgins et al., 1994, European Bioinformatics Institute, http://www.ebi.ac.uk/clustalw/). Sequence format was Pearson (Fasta) (Pearson and Lipman, 1988); sequence type was nucleotide (nt). The sequences were submitted to GenBank data base to get the accession numbers.
Phylogenetic tree
Phylogenetic trees were generated by TREEVIEW tree drawing software for windows (version 1.6.6, Page, 1996) from aligned nucleotide sequence by CLUSTAL W program. To observe the tree type, we used Neighbor-Joining (NJ) as distance method (Saitou and Nei, 1987), phylogeny inference package (PHYLIP) as parsimony method (version 3.4., Felsenstein, 1989, 1993). Alignment gaps were treated as missing data (Hendy and Penny, 1982, Hillis et al., 1996). The correction for nucleotide distance was done by the Kimura's 2 parameter method (Kimura, 1980). The phylogenetic trees were outgroup rooted using the 28S D1 rDNA and mtCOI gene nucleotide sequences of S. falcatus, because it represented a sister taxon.
The length of the 28S D1 region rDNA sequence of the three Metagonimus species was 248 bp (adjusted for missing data) and its G+C content was 52% (M. takahashii, M. yokogawai and M. miyatai). Nucleotide sequence differences among Metagonimus species were less than 0.8% (2/248 bp), and that between the species, 0.4% (1/248 bp). There was no sequence gap in 28S D1 rDNA region (Fig. 1). The length of the mtCOI sequence averaged 400 bp (398-403 bp, adjusted for missing data) with a G+C content ranged from 44% (M. miyatai), 46% (M. takahashii) to 47% (M. yokogawai) (data not shown). Nucleotide sequence differences between species were 23.0% (92/400 bp) between M. miyatai and M. takahashii, 16.2% (65/400 bp) between M. miyatai and M. yokogawai, 13.2% (53/400 bp) between M. takahashii and M. yokogawai adjusted for missing data (Fig. 2). Nucleotide gaps sequence differences were 2.5% (10/400 bp) between M. miyatai and M. takahashii, 2.7% (11/400 bp) between M. miyatai and M. yokogawai, and 2.4% (11/400 bp) between M. takahashii and M. yokogawai (Fig. 2). The aligned sequences of three Metagonimus species showed high similarities with other comparative human intestinal trematodes (P. summa and S. falcatus) for 28S D1 rDNA (95.0%, 234/248 bp and 94%, 233/248 bp) and the mtCOI gene (68.5%: 274/400 bp and 78.0%: 312/400 bp) from nucleotide BLAST database program in NCBI (Figs. 1, 2). M. takahashii and M. yokogawai placed in the same clade supported by DNA sequence and phylogenetic tree analysis for 28S D1 rDNA and mtCOI gene by neighbor-joining and parsimony method. M. miyatai placed in different clade from two other Metagonimus species (Figs. 3, 4).
Our data coincided with the previously reported data, i.e., general morphology, PCR-RFLP, PCRRAPD and SSR-PCR patterns of the three Metagonimus species. Rim et al. (1996) reported that the general morphology of the three species of Metagonimus was distinct and M. miyatai type was distinctive from other species of Metagonimus. Yu et al (1997a & 1997b) suggested that the M. miyata type had different DNA sequences from M. yakogawai by RAPD and RFLP patterns of ITS1 and mtCOI gene. Yang et al. (2000) showed that the three species of Metagonimus had different genotypes. Our data supported the suggestions of previous genetic studies. However, sequence data did not coincide with the results of the chromosome analyses of these three Metagonimus species. Lee et al. (1999) also suggested that the karyology of Metagonimus species had closer relationship between M. miyatai and M. takahashii (both 2n = 18) rather than between M. miyatai and M. yokogawai (2n = 32). This kind of discrepancy may be seen between karyologic and sequencing studies. We add a genetic evidence on the distinctness of M. miyatai from M. yokogawai and M. takahashii.

This study was supported by the Academic Research Fund of Ministry of Education, Republic of Korea, 1997-1998 (Grant No. BM 97-204).

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession numbers (Metagonimus miyatai: AF095333, M. takahashii: AF095332, M. yokogawai: AF095331).

  • 1. Bowles J, McManus DP. Genetic characterization of the Asian Taenia, a newly described Taenid cestode of humans. Am J Trop Med Hyg 1994;50:33-44.
  • 2. Chai JY, Guk SM, Han ET, et al. Surface ultrastructure of Metagonimus takahashii metacercariae and adults. Korean J Parasitol 2000a;38:9-15.
  • 3. Chai JY, Han ET, Park YK, Guk SM, Kim JL, Lee SH. High endemicity of Metagonimus yokogawai infection among residents of Samchok-shi, Kangwon-do. Korean J Parasitol 2000b;38:33-36.
  • 4. Chai JY, Huh S, Yu JR, Kook JN, Jung KC. An epidemiological study of metagonimiasis along the upperreaches of the Namhan River. Korean J Parasitol 1993;31:99-108.
  • 5. Chai JY, Kang YJ, Choi SY, Guk SM, Yu JR, Lee SH. Surface ultrastructure of Metagonimus miyatai metacercariae and adults. Korean J Parasitol 1998;36:217-225.
  • 6. Chai JY, Sohn WM, Kim MH, Hong ST, Lee SH. Three morphological types of the genus Metagonimus encysted in the dace, Tribolodon taczanowsjii, caught from the Sumjin river. Korean J Parasitol 1991;29:217-225.
  • 7. Felsenstein J. PHYLIP-Phylogeny inference package (version 3.2). Cladistics 1989;5:164-166.
  • 8. Felsenstein J. PHYLIP (Phylogeny Inference Package), version 3.5c. 1993, Seattle. Department of Genetics, University of Washington.
  • 9. Hassounna N, Michot B, Bachellerie JP. The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Res 1984;12:3563-3583.
  • 10. Hendy MD, Penny D. Branch and bound algorithms to determine minimal evolutionary trees. Math Biosc 1982;59:277-290.
  • 11. Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, Gibson TJ. CLUSTA W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673-4680.
  • 12. Hillis DM, Moritz C, Mable BK. In Swofford Davis L., Olsen Gary J., Waddell Peter J., Hillis Davis M. eds, Chapter 11, Phylogenetic Inference. Molecular Systematics. 1996, 2nd ed. Sunderland, Massachusetts, USA. Sinauer Associates, Inc. Publishers. pp 407-514.
  • 13. Katsurada F. Heterophyes in Japan, II. Creation of a new genus Metagonimus. Okayama Igakkai Zasshi 1912;273:768-778. (in Japanese).
  • 14. Kim CH, Kim NM, Lee CH, Park JS. Studies on the Metagonimus fluke in the Daechung reservoir and the upper stream of Geum river. Korean J Parasitol 1987;25:69-82.
  • 15. Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980;16:111-120.
  • 16. Lee GS, Cho IS, Lee YH, et al. Epidemiological study of clonorchiasis and metagonimiasis along the Geumgang (river) in Okcheon-gun (County), Korea. Korean J Parasitol 2002;40:9-16.
  • 17. Lee SU, Huh S, Park GM, Chai JY. A cytogenetic study of human intestinal parasites of the Genus Metagonimus (Digenea: Heterophyidae) in Korea. Korean J Parasitol 1999;37:237-241.
  • 18. Ministry of Health and Social Welfare. Korea Association of Health. Prevalence of intestinal parasitic infections in Korea. The sixth report (Monographic series). 1997, Seoul, Korea. pp 1-71.
  • 19. Miyata I. Supplementary discussion on the classification of the genus Metagonimus. Shokubutsu Oyobi Cobutsu 1941;9:533-534. (in Japanese).
  • 20. Miyata I. Some discussions on the classification of the genus Metagonimus in Japan. Dobutsugaku Zasshi 1944;56(1-3):6-19. (in Japanese).
  • 21. Page RDM. TREEVIEW: an application to display phylogenetic trees on personal computer. Comput Appl Biosci 1996;12:357-358.
  • 22. Pearson WR, Lipman DJ. Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 1988;85:2444-2448.
  • 23. Qu LH, Nioloso M, Bachellerie JP. Phylogenetic calibration of the 5' terminal domain of large rRNA achieved by determining twenty eukaryotic sequences. J Mol Evol 1988;28:113-124.
  • 24. Rim HJ, Kim KH, Joo KH. Classification and host specificity of Metagonimus spp. from Korean freshwater fish. Korean J Parasitol 1996;34:7-14.
  • 25. Saito S. Species differentiation of genus Metagonimus. Reports on Meeting for Parasite Taxonomy and Morphology, Japan 1984;2:1-4.
  • 26. Saito S, Chai JY, Kim KH, Lee SH, Rim HJ. Metagonimus miyatai sp. nov. (Digenea: Heterophyidae), a new intestinal trematode transmitted by fresh water fishes in Japan and Korea. Korean J Parasitol 1997;35:223-232.
  • 27. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-425.
  • 28. Sambrook J, Russell DW. Chapter 6. Molecular cloning: a laboratory manual. 2001, 3rd ed. New York, USA. Cold Spring Harbor Laboratory Press. pp 6.1-6.30.
  • 29. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463-5467.
  • 30. Suzuki M. On Metagonimus yakogawai. Collected papers on studies of special animals in Okayama Prefecture. 1930, pp 146-168. pp XXII-XXIII Pls.(in Japanese).
  • 31. Yang HJ, Guk SM, Han ET, Chai JY. Molecular differentiation of three species of Metagonimus by simple sequence repeat anchored polymerase chain reaction (SSR-PCR) amplification. J Parasitol 2000;86:1170-1172.
  • 32. Yu JR, Chung JS, Chai JY. Differential RAPD patterns between Metagonimus yokogawai and Metagonimus Miyata type. Korean J Parasitol 1997a;35:295-298.
  • 33. Yu JR, Chung JS, Huh S, Lee SH, Chai JY. PCR-RFLP pattern of three kinds of Metagonimus in Korea. Korean J Parasitol 1997b;35:271-276.
  • 34. Yu JR, Kwon SO, Lee SH. Clonorchiasis and metagonimiasis in the inhabitants along Talchongang (River), Chungwon-gun. Korean J Parasitol 1994;32:267-269.
Fig. 1
Sequences alignment of 28S D1 rDNA region of Metagonimus species. An asterisk (*) denotes an identical nucleotide position, and alignment gaps are indicated by a hyphen. Sequences for each species have been deposited in the GenBank databases (GenBank accession number: M. miyatai: AF095333, M. takahashii: AF095332, M. yokogawai: AF095331, P. summa: AF181885, S. falcatus: AF181886).
kjp-42-129-g001.jpg
Fig. 2
Sequences alignment of mtCOI region of Metagonimus species. An asterisk (*) denotes an identical nucleotide position, and alignment gaps are indicated by a hyphen. Sequences for each species have been deposited in the GenBank databases (GenBank accession number: M. miyatai: AF096232, M. takahashii: AF096231, M. yokogawai: AF096230, P. summa: AF181884, S. falcatus: AF181887).
kjp-42-129-g002.jpg
Fig. 3
Phylogenetic trees of Metagonimus species inferred from the 28S rDNA D1 gene nucleotide sequences by TREEVIEW program with the neighbor-joining and parsimony methods. The phylogenetic trees were outgroup rooted using the 28S D1 gene nucleotide sequence of Stellantchasmus falcatus.
kjp-42-129-g003.jpg
Fig. 4
Phylogenetic trees of Metagonimus species inferred from the mtCOI gene nucleotide sequences by TREEVIEW program with the neighbor-joining and parsimony methods. The phylogenetic trees were outgroup rooted using the mtCOI gene nucleotide sequence of Stellantchasmus falcatus.
kjp-42-129-g004.jpg

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai
Korean J Parasitol. 2004;42(3):129-135.   Published online September 20, 2004
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai
Korean J Parasitol. 2004;42(3):129-135.   Published online September 20, 2004
Close

Figure

  • 0
  • 1
  • 2
  • 3
Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai
Image Image Image Image
Fig. 1 Sequences alignment of 28S D1 rDNA region of Metagonimus species. An asterisk (*) denotes an identical nucleotide position, and alignment gaps are indicated by a hyphen. Sequences for each species have been deposited in the GenBank databases (GenBank accession number: M. miyatai: AF095333, M. takahashii: AF095332, M. yokogawai: AF095331, P. summa: AF181885, S. falcatus: AF181886).
Fig. 2 Sequences alignment of mtCOI region of Metagonimus species. An asterisk (*) denotes an identical nucleotide position, and alignment gaps are indicated by a hyphen. Sequences for each species have been deposited in the GenBank databases (GenBank accession number: M. miyatai: AF096232, M. takahashii: AF096231, M. yokogawai: AF096230, P. summa: AF181884, S. falcatus: AF181887).
Fig. 3 Phylogenetic trees of Metagonimus species inferred from the 28S rDNA D1 gene nucleotide sequences by TREEVIEW program with the neighbor-joining and parsimony methods. The phylogenetic trees were outgroup rooted using the 28S D1 gene nucleotide sequence of Stellantchasmus falcatus.
Fig. 4 Phylogenetic trees of Metagonimus species inferred from the mtCOI gene nucleotide sequences by TREEVIEW program with the neighbor-joining and parsimony methods. The phylogenetic trees were outgroup rooted using the mtCOI gene nucleotide sequence of Stellantchasmus falcatus.
Sequence comparisons of 28S ribosomal DNA and mitochondrial cytochrome c oxidase subunit I of Metagonimus yokogawai, M. takahashii and M. miyatai