Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Evolutionary course of CsRn1 long-terminal-repeat retrotransposon and its heterogeneous integrations into the genome of the liver fluke, Clonorchis sinensis

The Korean Journal of Parasitology 2003;41(4):209-219.
Published online: December 20, 2003

Department of Molecular Parasitology and Center for Molecular Medicine, Sungkyunkwan University School of Medicine and Samsung Biomedical Research Institute, Suwon 440-746, Korea.

Corresponding author (kongy@yurim.skku.ac.kr)
• Received: November 12, 2003   • Accepted: November 23, 2003

Copyright © 2003 by The Korean Society for Parasitology

  • 8,838 Views
  • 64 Download
  • 8 Crossref
  • 13 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Recurrent emergence of structural variants of LTR retrotransposon CsRn1 evolving novel expression strategy and their selective expansion in a carcinogenic liver fluke, Clonorchis sinensis
    Seon-Hee Kim, Yoon Kong, Young-An Bae
    Molecular and Biochemical Parasitology.2017; 214: 14.     CrossRef
  • Genomics and transcriptomics of the Chinese liver fluke Clonorchis sinensis (Opisthorchiidae, Trematoda)
    G. N. Chelomina
    Molecular Biology.2017; 51(2): 184.     CrossRef
  • Egg-specific expression of protein with DNA methyltransferase activity in the biocarcinogenic liver fluke Clonorchis sinensis
    SEON-HEE KIM, HYE-JEONG CHO, WOON-MOK SOHN, CHUN-SEOB AHN, YOON KONG, HYUN-JONG YANG, YOUNG-AN BAE
    Parasitology.2015; 142(9): 1228.     CrossRef
  • Progress on the transcriptomics of carcinogenic liver flukes of humans—Unique biological and biotechnological prospects
    Neil D. Young, Aaron R. Jex, Cinzia Cantacessi, Bronwyn E. Campbell, Thewarach Laha, Woon-Mok Sohn, Banchob Sripa, Alex Loukas, Paul J. Brindley, Robin B. Gasser
    Biotechnology Advances.2010; 28(6): 859.     CrossRef
  • The biology and evolution of transposable elements in parasites
    M. Carmen Thomas, Francisco Macias, Carlos Alonso, Manuel C. López
    Trends in Parasitology.2010; 26(7): 350.     CrossRef
  • Functional Genes and Proteins of Clonorchis sinensis
    Tae Im Kim, Byoung-Kuk Na, Sung-Jong Hong
    The Korean Journal of Parasitology.2009; 47(Suppl): S59.     CrossRef
  • Molecular genetic profiles among individual Clonorchis sinensis adults collected from cats in two geographic regions of China revealed by RAPD and MGE-PCR methods
    De-Hua Lai, Qiao-Ping Wang, Wen Chen, Lian-Shun Cai, Zhong-Dao Wu, Xing-Quan Zhu, Zhao-Rong Lun
    Acta Tropica.2008; 107(2): 213.     CrossRef
  • PwRn1, a novel Ty3/gypsy-like retrotransposon of Paragonimus westermani: molecular characters and its differentially preserved mobile potential according to host chromosomal polyploidy
    Young-An Bae, Jong-Sook Ahn, Seon-Hee Kim, Mun-Gan Rhyu, Yoon Kong, Seung-Yull Cho
    BMC Genomics.2008;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Evolutionary course of CsRn1 long-terminal-repeat retrotransposon and its heterogeneous integrations into the genome of the liver fluke, Clonorchis sinensis
Korean J Parasitol. 2003;41(4):209-219.   Published online December 20, 2003
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Evolutionary course of CsRn1 long-terminal-repeat retrotransposon and its heterogeneous integrations into the genome of the liver fluke, Clonorchis sinensis
Korean J Parasitol. 2003;41(4):209-219.   Published online December 20, 2003
Close

Figure

  • 0
  • 1
  • 2
Evolutionary course of CsRn1 long-terminal-repeat retrotransposon and its heterogeneous integrations into the genome of the liver fluke, Clonorchis sinensis
Image Image Image
Fig. 1 A phylogenetic tree of CsRn1 LTR sequences. Each sequence is labeled as CsKK followed by numbers representing each lambda clone and position of the LTR sequence in the corresponding CsRn1 copy. For CsRn1 copies in which both LTRs were sequenced, the 3'-LTR sequences were used in the analysis. The tree was constructed by the neighbor-joining algorithm using the PHYLIP package and was rooted with CsKK-92-3. Bootstrap values of only branching nodes separating the major clusters of CsRn1 copies are shown as numbers at the nodes. Roman numerals in the left indicate the recognized subsets of CsRn1 as mentioned in the text.
Fig. 2 Banding patterns of inter-retrotransposon amplified polymorphism (IRAP) among individual genomes of C. sinensis. Genomic DNAs were separately extracted from individuals of the trematode and used in PCR reactions as templates, to detect IRAP markers. Primers used in the reactions were designed from the 5'-(5'-ACGATTATGCAATTGATG-3') and the 3'-ends (5'-TATTTCTTTGCCACACAC-3') of a consensus LTR sequence of CsRn1 in the outward direction. Amplified fragments were electrophoresed on an agarose gel and visualized by ethidium bromide staining. Reversed image of the stained gel is presented. Numbers on top of each lane represent individual C. sinensis worms. The positions of the DNA size standards (in kb) are shown in the left.
Fig. 3 Examples of PCR amplification for the locus-specific typing of CsRn1. PCRs performed with locus-specific (see Table 3) and CsRn1 specific primers (5'-GAAACTTGAAGTGAGCAAC-3') by using the genomic DNAs of C. sinensis individually extracted. CsRn1-containing loci and their subset numbers in parentheses are presented. A. Agarose gel analysis of the PCR products. After being electrophoresed, the amplicons were visualized by ethidium bromide staining; B. Autoradiographs of the PCR products probed with the LTR sequence of CsRn1. Numbers on top of each lane represent individual worms of C. sinensis. M, 100-bp DNA ladder. C, positive control with each corresponding lambda clone as template. Template control reactions were performed to check the relative amounts and purities of each template DNA with primers for a cysteine protease (GenBank accession No. AF271091, 5'-GCTGGACTCCGACTACCCATATG-' and 5'-GGTTTAAACGATTGTGCATCGC-3').
Evolutionary course of CsRn1 long-terminal-repeat retrotransposon and its heterogeneous integrations into the genome of the liver fluke, Clonorchis sinensis
Subset No. of sequences (%)a) Mean ± SD of % divergenceb)
I 6 (11) 6.7 ± 2.5
II 8 (14) 2.2 ± 0.6
III 17 (30) 1.6 ± 0.5
IV 21 (37) 0.4 ± 0.2
Subset Locus Similarity (%)a)
Base substitutions in codons of rt
LTR rt First Second Third
I CsRn1-20 96.54 98.32 5 4 0
CsRn1-41 96.76 97.39 4 5 5
II CsRn1-26 98.49 97.58 2 7 4
CsRn1-89 96.76 98.51 0 4 4
III CsRn1-2 98.49 99.63 1 1 0
CsRn1-4 99.35 99.63 1 0 1
CsRn1-54 98.14 99.81 0 1 0
CsRn1-77 98.92 99.81 0 0 1
CsRn1-86 99.14 99.63 0 1 1
IV CsRn1-7 99.57 99.81 0 0 1
CsRn1-39 99.35 100 0 0 0
CsRn1-74 99.35 99.81 0 1 0
CsRn1-10 99.78 100 0 0 0
CsRn1-15 99.78 100 0 0 0
CsRn1-81 99.78 100 0 0 0
CsRn1-82 99.78 100 0 0 0
Subset Locus Primer (5’ → 3’)a) Polymorphic Indexb) Flanking sequencec)
I CsRn1-41 ACAGTCTTTCAGGTAAGCAC 0 (13/13) No match
II CsRn1-44 CATCGAGCAACTGAGATTGC 0 (13/13) No match
III CsRn1-2 ATTCAGCGCAAAGCCACTG 0 (13/13) Non-LTR pol gene
CsRn1-4 GAGATGACCTATTTAAGGTC 7.7 (12/13) No match
CsRn1-77 ACGGCACTGACTGATTCAAC 0 (13/13) No match
IV CsRn1-7 GCGAGAACTTACATAAGTGAG 92.3 (1/13) Non-LTR pol gene
CsRn1-8 GGAGCTGGTAGGTCACATG 0 (10/10) No match
CsRn1-16 ACTGGCATTGGATCTCTTCG 20 (8/10) Non-LTR pol gene
CsRn1-19 TGATACAGTCTCCATTGACC 88.9 (1/10) Non-LTR pol gene
CsRn1-39 TCAGCTGTAAGAAGTGCGTG 92.3 (1/13) Non-LTR pol gene
CsRn1-68 AAGTAAGGCGTTATAATGCAGT 0 (10/10) No match
CsRn1-74 TCGGACCGCATGAATAGCTG 0 (10/10) No match
CsRn1-85 TCGACCACTGCTACTTGTAG 30 (7/10) Non-LTR pol gene
CsRn1-10 ATCAAACCGCCTAGTTGAGC 0 (13/13) No match
CsRn1-15 ATGACTTCATTGTTGACACTG 15.4 (11/13) gag gene
CsRn1-81 CACACTGATAATGTCGTAGC 0 (13/13) No match
CsRn1-82 CAAGTAGCACGTATGTATTCG 84.6 (2/13) gag gene
Table 1. Sequence divergences of CsRn1 LTR sequences

Fraction of each subset in the total of 57 CsRn1 copies sequenced is presented as percentage.

Nucleotides from all available positions were used to calculate the degree of nucleotide substitutions in a sequence alignment, after removing all positions with gap.

Table 2. Nucleotide sequence conservations in LTR and rt regions of CsRn1 subsets, and the positions of base substitutions in rt regions

Percent similarity was calculated between each sequence and a consensus sequence.

Table 3. Distribution patterns of CsRn1 among C. sinensis individuals and their flanking region sequences

Reverse primers are listed. 3I-Fow was used as a forward primer (see Materials and Methods).

Expressed as a percentage of absence. (1 – No. of CsRn1 – containing worms/No. of tested worms) × 100.

Sequence of each flanking region was used as a query to search for similarity against GenBank database using BLASTX and P(N) < 0.001 was taken to indicate significance for each homology search.