Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis

The Korean Journal of Parasitology 2009;47(2):145-151.
Published online: May 27, 2009

1Department of Parasitology and Tropical Medicine and Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 110-799, Korea.

2Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul 110-799, Korea.

3Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 135-710, Korea.JFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

Corresponding author (hst@snu.ac.kr)
• Received: February 4, 2009   • Revised: April 2, 2009   • Accepted: April 7, 2009

Copyright © 2009 by The Korean Society for Parasitology

  • 9,061 Views
  • 69 Download
  • 3 Crossref
  • 4 Scopus
prev next
  • This study examined the association of cytokine gene polymorphisms with intrahepatic bile duct wall fibrosis in human clonorchiasis. A total of 240 residents in Heilongjiang, China underwent ultrasonography, blood sampling, and stool examination. Single nucleotide polymorphism (SNP) sites for IFN-γ (+874 T/A), IL-10 (-1,082 G/A, -819 C/T, -592 C/A), TNF-α (-308 G/A), and TGF-β1 (codon 10 T/C, codon 25 G/C) genes were observed with the TaqMan allelic discrimination assay. No significant correlation was observed between individual cytokine gene polymorphisms and intrahepatic duct dilatation (IHDD). Among individuals with clonorchiasis of moderate intensity, the incidence of IHDD was high in those with IFN-γ intermediate-producing genotype, +874AT (80.0%, P = 0.177), and in those with TNF-α low-producing genotype, -308GG (63.0%, P = 0.148). According to the combination of IFN-γ and TNF-α genotypes, the risks for IHDD could be stratified into high (intermediate-producing IFN-γ and low producing TNF-α), moderate, and low (low-producing IFN-γ and high producing TNF-α) risk groups. The incidence of IHDD was significantly different among these groups (P = 0.022): 88.9% (odds ratio, OR = 24.0) in high, 56.5% (OR = 3.9) in moderate, and 25.0% (OR = 1) in low risk groups. SNP of IFN-γ and TNF-α genes may contribute to the modulation of fibrosis in the intrahepatic bile duct wall in clonorchiasis patients.
Clonorchis sinensis is endemic in most of East Asian countries, and its prevalence depends upon the distribution of intermediate hosts and fish-eating habits of residents. Clonorchiasis is a major health problem in those endemic areas because it results in serious pathological changes in the intrahepatic bile ducts and surrounding tissues. The pathological changes include peri-ductal inflammation, biliary mucosal hypertrophy, bile duct dilatation, peri-ductal fibrosis and wall thickening, metamorphosis of mucus-secreting cells, and neoplastic changes in the biliary epithelial cells [1]. The degree of pathological change varies according to intensity and chronicity of the infection [2].
Peri-ductal fibrosis and the wall thickening is a major pathological change in clonorchiasis and is generally induced by complicated interactions between infiltrating cells, cytokines, and the extracellular matrix. The over-production of the extracellular matrix during bile duct fibrosis in schistosomiasis is regulated by cytokines produced by activated Kupffer cells in the liver [3]. The activated Kupffer cells produce several kinds of cytokines such as TGF-α, TGF-β1, TNF-α, PDGF, IL-10, and IFN-γ. Of the cytokines, IFN-γ, IL-10, TNF-α, and TGF-β1 are known to modulate hepatic fibrosis in alcoholic liver disease and hepatitis C, and production of these cytokines is affected by gene polymorphisms [4]. Schistosoma japonicum egg deposition in the liver results in hepatic fibrosis, and the degree of fibrosis is modulated by MHC class II and IL-13 gene polymorphisms [5].
Peri-ductal hepatic fibrosis in clonorchiasis can be estimated by sonography of the liver [6], but its correlation with cytokine gene polymorphisms is still unknown. We postulate that the peri-ductal fibrosis in clonorchiasis is modulated by cytokines and also by their genetic polymorphisms. Our study was designed to demonstrate and elucidate any correlation of cytokine gene single nucleotide polymorphisms with liver pathology in patients with clonorchiasis.
Subjects and examinations
A total of 531 residents, whole available residents of one village, were examined in a clonorchiasis endemic area in Heilongjiang, China, in 2004. Feces from the subjects were examined by the Kato-Katz method and the number of eggs per gram (EPG) was quantified [7]. The subjects were classified into 3 groups based on fecal examination results: 1) EPG = 0, negative infection, 2) EPG = 1-299, and 3) EPG ≥ 300. Genetic analysis of the subjects was performed through blood samples. Infected individuals were treated with praziquantel at a dose of 25 mg/kg and administered 3 times over a single day. The subjects agreed to participate in this study by oral communication, and 240 individuals of the 531 finished all examinations and their data are included in this study.
Ultrasonography
Two experienced radiologists with no clinical information about participating subjects performed ultrasonographic studies using a SonoAce 5500 ultrasound scanner (Medison, Seoul, Korea) equipped with a 3-6 convex-array transducer. Intrahepatic duct dilatation (IHDD) and periductal echogenicity (PDE) were ultrasonographically identified as previously described [6].
DNA extraction and analysis of cytokine gene polymorphisms
Fingertip blood from participating subjects was absorbed on filter papers and transported to the laboratory in Seoul, Korea. DNA was extracted from the filter papers using the Chelex-100 resin protocol (BioRad, Hercules, California, USA). Specific primers and probes were designed in order to analyze single nucleotide polymorphisms (SNP) of the IFN-γ, IL-10, TNF-α, and TGF-β1 genes (Table 1) [8-10]. Also the TaqMan (Applied Biosystems, Foster City, California, USA) real-time PCR allelic discrimination assay was applied [9]. TaqMan probes and PCR primers were used to analyze SNP genotypes. A pair of TaqMan probes contained each polymorphism site and complementary nucleotides for each genotype. A mixture of 10 ng of DNA, 900 nM of primers, 200 nM of probes, and 2X TaqMan Universal PCR mix (Perkin-Elmer, Applied Biosystems) underwent reaction with real-time PCR conditions of 50℃ for 2 min, 95℃ for 10 min and 92℃ for 30 sec 60℃ for 1 min for 50 cycles. The products were sequenced and sequences were grouped by SNP.
Statistical analysis
A total of 7 known SNP sites were analyzed for linkage of genotypes, clonorchiasis intensity, and sonographic data using the SPSS 12 software. The SNP sites which were examined were IFN-γ (+874 T/A), IL-10 (-1,082 G/A, -819 C/T, -592 C/A), TNF-α (-308 G/A), and TGF-β1 (codon 10 T/C, codon 25 G/C).
Demography of subjects and fecal examination
A total of 240 subjects (124 males and 116 females) were examined with a median age of 40 years (range, 9 to 80 years). Fecal examination detected eggs of C. sinensis in 171 subjects, with light infection in 65.5% and moderate infection in 35.5% of positives. Samples were negative for screening of other helminth eggs. Individuals under 10 years of age did not have positive fecal samples. Positive fecal samples were seen in subjects aged 10-20 years (31.3%), 21-30 years (66.7%), 31-40 years (76.4%), 41-50 years (82.7%), 51-60 years (80.3%), and 61 years or older (38.1%).
Ultrasonography
Ultrasonography revealed a diagnosis of IHDD in 106 (44.2%) and PDE in 101 (42.1%) of the 240 subjects.
Analysis of cytokine gene polymorphisms
The intermediate-producing genotype, AT (17.9%) and low-producing genotype, AA (82.1%) were observed at +874 T/A for IFN-γ analysis [10]. The low-producing genotype, AA (85.4%) and the intermediate-producing genotype, AG (14.6%) at -1,082 G/A, TT (45.0%), TC (49.2%), and CC (5.8%) genotypes at -819 C/T, and AA (45.0%), AC (48.8%), and CC (6.3%) genotypes at -592 C/A were also observed for IL-10 analysis [11]. The high-producing genotype, GA (9.6%) and the low-producing genotype, GG (90.4%) were detected at -308 G/A for TNF-α analysis. The high-producing genotype, TC (55.0%) or TT (27.1%), and the low-producing genotype CC (17.9%) for TGF-β1 were found at codon 10 T/C and the genotype GG only at codon 25 G/C (Table 2) [12]. This cytokine gene polymorphism data from Chinese subjects were similar to those seen in Koreans [11,12].
Relation between cytokine gene SNPs and pathology caused by clonorchiasis
Participants were divided into 3 groups based on EPG counts: negative, EPG 1-299, and EPG ≥ 300, and were further divided into 6 groups based on degree of IHDD (Table 3) and PDE (Table 4). All groups were compared to assess genotype and allele frequencies, but none of the comparisons was statistically significant. Gene polymorphisms of IL-10 and TGF-β1 revealed no differences in the incidence of bile duct fibrosis among individuals with negative, light, and moderate infections. Among individuals with clonorchiasis of EPG 300 or more, the intermediate-producing IFN-γ genotype, +874AT, revealed a higher incidence of fibrosis than the low-producing genotype, +874AA (80.0% vs 55.1%; odds ratio, OR = 3.3; P = 0.177), and the low-producing TNF-α genotype, -308GG, revealed a higher incidence of fibrosis than the high-producing genotype, -308GA (63.8% vs 20.0%; OR = 6.8; P = 0.148). However, these values did not reach statistical significance.
We analyzed the associations between cytokine genotypes and peri-ductal fibrosis in terms of IHDD. Combinations of IFN-γ and TNF-α genotypes were classified into 3 groups stratified for IHDD risks: high, moderate, and low risk groups. The incidence of IHDD was 25.0% in the low risk group (OR = 1), 56.5% in the moderate risk group (OR = 3.9), and 88.9% in the high risk group (OR = 24.0), and the differences were statistically significant by linear by linear association analysis (P = 0.022, Table 5).
The present study first investigated relations between host SNPs and liver pathology in clonorchiasis. The SNP genotype frequencies of the 4 cytokine genes at the polymorphic sites revealed no differences when examined by EPG counts. Furthermore, the cytokine genotype frequencies had no significant correlation with the liver pathologies determined by ultrasonography. IHDD is the result of fibrosis of the bile duct wall, and PDE is the result of inflammation surrounding the bile duct [13]. Although IHDD was the primary parameter evaluated in this analysis, it had no significant correlation with genotype or allele frequencies of individual cytokines.
However, a significant correlation was observed when the cytokine genotypes of IFN-γ and TNF-α were grouped in combination according to the risks for fibrosis [11,12]. Among individuals with clonorchiasis of EPG ≥ 300, the high risk group, intermediate-producing IFN-γ (+874AT) and low-producing TNF-α (-308GG) genotypes, was significantly correlated with development of IHDD (Table 5), but not with that of PDE. When the low risk group, low-producing IFN-γ(+874AA) and high-producing TNF-α(-308GA), was used as a reference (OR = 1), the moderate (OR = 3.9) and high (OR = 24.0) risk groups had significantly increased frequencies of IHDD (P = 0.022). The incidence of IHDD frequency was significantly different between different genotype groups despite the inclusion of only 59 total subjects with clonorchiasis of EPG ≥ 300. In our study, 9 of 59 individuals (15.3%) belonged to the high risk group for fibrosis, and 8 of these individuals (88.9%) developed IHDD. Fibrosis in this group was severe and persisted after praziquantel treatment, and therefore IHDD cases by liver ultrasonography must be strongly considered as clonorchiasis even if they are cured in endemic areas.
A few individuals, 4 of 59 (6.8%) belonged to the low risk group for fibrosis, and the bile duct walls in these individuals had minimal fibrosis and only one of these individuals (25%) had IHDD. It is possible that this group of SNPs may contribute to the majority of negative hepatic ultrasonographic findings in clonorchiasis patients. Though the numbers of this low risk group were only 4 and looked insufficient, we may suggest the tendency of the tissue reaction compared with that of other groups.
Most subjects (46/59, 78.0%) belonged to the moderate risk group for fibrosis, having intermediate-producing IFN-γ (+874AT) and high-producing TNF-α (-308GA) genotype or low-producing IFN-γ (+874AA) and low-producing TNF-α (-308GG) genotype. More than half (26/46, 56.5%) of the individuals in the moderate risk group had IHDD, which was similar to the frequencies of clonorchiasis IHDD cases as previously reported in China [14]. The individuals in this moderate risk group may develop fibrosis secondary to C. sinensis infection and resolve after treatment, and this may be the most representative hepatic disease progression in clonorchiasis.
It is well-known that TNF-α, IFN-γ, IL-10, and TGF-β1 polymorphisms affect cytokine production in either suppression or stimulation. In several liver diseases, low-producing IL-10 and high-producing IFN-γ and TGF-β1 genotypes are known to promote hepatic fibrosis, but the action of TNF-α is unclear [10]. Similarly, rejection in kidney transplantation was reported to occur more frequently among individuals with high risk IFN-γ and TNF-α genotype combinations than those of moderate or low risk genotypes [12].
Fibrosis during clonorchiasis occurs as a consequence of periductal inflammation and surrounds the bile duct to induce the ductal wall thickening. Inflammation sites in the ductal wall contain numerous inflammatory or immune cells which secrete multiple cytokines, and the cytokines are mixed in the tissue and may modulate tissue reactions in complicated ways according to genotype polymorphisms. Complicated tissue reactions in the liver may explain the reason that liver ultrasonography in infected humans have displayed low sensitivity and specificity [6,14]. A small proportion of clonorchiasis patients will have negative liver scans on ultrasonography as false negatives. Conversely, some egg negative individuals from endemic areas will show IHDD on scans as false positives [6]. Most ultrasonographic false positives may have residual bile duct fibrosis after treatment although a portion may be actively infected but found egg negative. This suggests that the livers of infected individuals respond to the liver fluke in different ways depending on the genetic polymorphisms of hosts. The IFN-γ and TNF-α SNPs may contribute to the different tissue responses observed by ultrasonography.
IFN-γ stimulates cellular immunity by activation of Th1 lymphocytes, cytolytic T lymphocytes, and natural killer cells. A study on IFN-γ gene polymorphism associated with Schistosoma mansoni liver pathology revealed that, +2,109 A/G genotype promoted hepatic fibrosis and +3,810 G/A genotype inhibited it [15]. Our study suggests that +874AT genotype of IFN-γ may play a key role for bile duct fibrosis in clonorchiasis.
Henri et al. [3] suggested that bile duct fibrosis was additionally promoted by TNF-α, but another study indicated that TNF-α gene polymorphisms in Schistosoma mansoni infection did not directly affect liver fibrosis [16]. In our study on TNF-α the low-producing genotype produced more fibrosis than the high-producing genotype (63% vs 20%), and this indicates that TNF-α may suppress fibrosis in the liver.
The genotypes and allelic frequencies of IFN-γ, IL-10, TNF-α, and TGF-β1 genes in Chinese subjects were similar to those seen in Koreans [11,12], and based on these similarities the genotype polymorphisms associated with clonorchiasis were also expected to be similar to those in Koreans.
In conclusion, individuals with combination genotypes of the intermediate-producing IFN-γ (+874AT) and the low-producing TNF-α (-308GG) have a higher risk of developing liver fibrosis than other combinations of genotypes in clonorchiasis. Such SNP polymorphisms may contribute to the various sonographic findings in clonorchiasis.
We appreciate Ms. Zhuo Ji, Mr. Gui Yu, and other staff of Heilongjiang CDC for their kind technical and administrative cooperation during this study. This study was financially supported by the grant from the Seoul National University College of Medicine Research Fund, #800-20040066.
    Table 1.
    Probe and primer combinations for cytokine polymorphism analysis using TaqMan real-time PCR allelic discrimination assay
    Table 1.
    Cytokines Positions Sequences
    INF-γ +874 T/A Probe-T CAAAATCAAATCTCACACACA
    Probe-A CAAAATCAAATCACACACAC
    Primer-F TCAGACATTCACAATTGATTTTATTCTTAC
    Primer-R AAGATAGTTCCAAACATGTGCGAG
    IL-10 -1,082 G/A Probe-G TTCCCCCTCCCAAAG
    Probe-A TTCCCCTTCCCAAAGA
    Primer-F TCCATGGAGGCTGGATAGGA
    Primer-R CACACAAATCCAAGACAACACTACTAAG
    -819 C/T Probe-C TGTAACATCTCTGTGCCT
    Probe-T TGATGTAATATCTCTGTGCC
    Primer-F TTGGCACTGGTGTACCCTTGT
    Primer-R CCGTCTCTATTTTATAGTGAGCAAACTG
    -592 C/A Probe-C CGCCTGTCCTGTAGG
    Probe-A CGCCTGTTATGTAGGA
    Primer-F TGTGCCTGAGAATCCTAATGAAATC
    Primer-R CCCTTCCATTTTACTTTCCAGAGA
    TNF-α -308 G/A Probe-G AGGGGCATGGGGA
    Probe-A AGGGGCATGAGGAC
    Primer-F GAAATGGAGGCAATAGGTTTTGA
    Primer-R GGCCACTGACTGATTTGTGTGT
    TGF-β1 Codon 10 T/C Probe-T CTGCTGCTGCTGCTGCTACCG
    (-869) Probe-C CTGCTGCCGCTGCTGCTACC
    Primer-F CCACACCAGCCCTGTTCG
    Primer-R CCAGGCGTCAGCACCAGTA
    Codon 25 G/C Probe-G CCTGGCCGGCCGGC
    (-915) Probe-C CCTGGCCCGCCGGC
    Primer-F TTCCCTCGAGGCCCTCCTA
    Primer-R GCCGCAGCTTGGACAGGATC
    Table 2.
    Genotype and allele frequencies of IFN-γ, IL-10, TNF-α and TGF-β1 genes in subjected population (n = 240)
    Table 2.
    Cytokines Positions Genotypes No. (%) of persons Allele Frequency (%)
    INF-γ +874 AA 197 (82.1) A 91.0
    AT 43 (17.9) T 9.0
    IL-10 -1,082 AA 205 (85.4) A 92.7
    AG 35 (14.6) G 7.3
    -819 TT 108 (45.0) T 69.6
    TC 118 (29.2) C 30.4
    CC 14 (5.8)
    -592 AA 108 (45.0) A 69.4
    AC 117 (48.8) C 30.6
    CC 15 (6.3)
    TNF-α -308 GG 217 (90.4) G 95.2
    GA 23 (9.6) A 4.8
    TGF-β1 Codon 10 (-869) TT 65 (27.1) T 54.6
    TC 132 (55.0) C 45.4
    CC 43 (17.9)
    Codon 25 (-915) GG 240 (100) G 100.0
    Table 3.
    Distribution of genotypes and alleles of 4 cytokines by EPG groups of Clonorchis sinensis in relation to intrahepatic duct dilatation (IHDD)
    Table 3.
    Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
    300 ≤ EPG
    IHDD (-) (%) IHDD (+) (%) IHDD (-) (%) IHDD (+) (%)
    INF-γ 874 AA 90 (60.8) 58 (39.2) 22 (44.9) 27 (55.1)a
    AT 20 (60.6) 13 (39.4) 2 (20.0) 8 (80.0)
    A 60.8 39.2 42.6 57.4
    T 60.6 39.4 20.0 80.0
    IL-10 -1,082 AA 95 (61.3) 60 (38.7) 20 (40.0) 30 (60.0)
    AG 15 (57.7) 11 (42.3) 4 (44.4) 5 (55.6)
    A 61.0 39.0 40.4 59.6
    G 57.7 42.3 44.4 55.6
    -819 TT 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0)
    TC 51 (57.3) 38 (42.7) 9 (31.0) 20 (69.0)
    CC 5 (55.6) 4 (44.4) 3 (60.0) 2 (40.0)
    T 62.4 37.6 41.8 58.2
    C 57.0 43.0 38.5 61.5
    -592 AA 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0)
    AC 50 (56.8) 38 (43.2) 9 (31.0) 20 (69.0)
    CC 6 (60.0) 4 (40.0) 3 (60.0) 2 (40.0)
    A 62.2 37.8 41.8 58.2
    C 57.4 42.6 38.5 61.5
    TNF-α -308 GG 99 (60.7) 64 (39.3) 20 (37.0) 34 (63.0)b
    GA 11 (61.1) 7 (38.9) 4 (80.0) 1 (20.0)
    G 61.1 38.9 80.0 20.0
    A 60.8 39.2 38.9 61.1
    TGF-β1 Codon 10 TT 37 (68.5) 17 (31.5) 4 (36.4) 7 (63.6)
    (-869) TC 52 (56.5) 40 (43.5) 17 (42.5) 23 (57.5)
    CC 21 (60.0) 14 (40.0) 3 (37.5) 5 (62.5)
    T 63.0 37.0 40.3 59.7
    C 58.0 42.0 41.1 58.9
    Codon 25 GG 110 (60.8) 71 (39.2) 24 (40.7) 35 (59.3)
    (-915) G 100.0 100.0 100.0 100.0

    aP = 0.177 (OR = 3.3, 95% CI 0.6-17.0), AT vs AA;

    bP = 0.148 (OR = 6.8, 95% CI 0.7 - 65.2), GG vs GA.

    Table 4.
    Distribution of genotypes and alleles of 4 cytokines between 2 EPG groups of Clonorchis sinensis in relation to periductal echogenicity (PDE)
    Table 4.
    Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
    300 ≤ EPG
    PDE (-) (%) PDE (+) (%) PDE (-) (%) PDE (+) (%)
    INF-γ 874 AA 87 (58.8) 61 (41.2) 26 (53.1) 23 (46.9)
    AT 23 (69.7) 10 (30.3) 3 (30.0) 7 (70.0)
    A 59.9 40.1 50.9 49.1
    T 69.7 30.3 30.0 70.0
    IL-10 -1,082 AA 92 (59.4) 63 (40.6) 26 (52.0) 24 (48.0)
    AG 18 (69.2) 8 (30.8) 3 (33.3) 6 (66.7)
    A 60.1 39.9 50.5 49.5
    G 69.2 30.8 33.3 66.7
    -819 TT 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0)
    TC 51 (57.3) 38 (42.7) 13 (44.8) 16 (55.2)
    CC 5 (55.6) 4 (44.4) 2 (40.0) 3 (60.0)
    T 62.4 37.6 51.9 48.1
    C 57.0 43.0 43.6 56.4
    -592 AA 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0)
    AC 50 (56.8) 38 (43.2) 13 (44.8) 16 (55.2)
    CC 6 (60.0) 4 (40.0) 2 (40.0) 3 (60.0)
    A 62.2 37.8 51.9 48.1
    C 57.4 42.6 43.6 56.4
    TNF-α -308 GG 99 (60.7) 64 (39.3) 26 (48.1) 28 (51.9)
    GA 11 (61.1) 7 (38.9) 3 (60.0) 2 (40.0)
    G 61.1 38.9 60.0 40.0
    A 60.8 39.2 48.7 51.3
    TGF-β1 Codon 10 TT 33 (61.1) 21 (38.9) 6 (54.5) 5 (45.5)
    (-869) TC 58 (63.0) 34 (37.0) 20 (50.0) 20 (50.0)
    CC 19 (54.3) 16 (45.7) 3 (37.5) 5 (62.5)
    T 62.0 38.0 51.6 48.4
    C 59.3 40.7 46.4 53.6
    Codon 25 GG 110 (60.8) 71 (39.2) 29 (49.2) 30 (50.8)
    (-915) G 100.0 100.0 100.0 100.0
    Table 5.
    Association of IFN-γ and TNF-α genotype combinations with intrahepatic duct dilatation (IHDD) in persons moderately infected with Clonorchis sinensis
    Table 5.
    IFN-γ and TNF-α genotypesa IHDD (-) IHDD (+)b OR (95% Cl)
    Group 1 : low producing 3 (75.0%) 1 (25.0%) 1.0 (reference)
     IFN-γ low, TNF-α high (n = 4)
    Group 2 : moderate producing 20 (43.5%) 26 (56.5%) 3.9 (0.4-40.4)
     IFN-γ intermediate, TNF-α high (n = 1)
     IFN-γ low, TNF-α low (n = 45)
    Group 3 : high producing 1 (11.1%) 8 (88.9%) 24.0 (1.1-516.4)
     IFN-γ intermediate, TNF-α low (n = 9)
    Total (n=59) 24 (40.7%) 35 (59.3%)

    aIFN-γ: intermediate producing genotype, +874AT; low producing, +874AA. TNF-α: high producing genotype -308GA; low producing, -308GG;

    bLinear by linear association analysis (P = 0.022).

    OR, odds ratio; CI, confidence interval.

    Download Citation

    Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

    Format:

    Include:

    Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
    Korean J Parasitol. 2009;47(2):145-151.   Published online May 27, 2009
    Download Citation

    Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

    Format:
    Include:
    Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
    Korean J Parasitol. 2009;47(2):145-151.   Published online May 27, 2009
    Close
    Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
    Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
    Cytokines Positions Sequences INF-γ +874 T/A Probe-T CAAAATCAAATCTCACACACA Probe-A CAAAATCAAATCACACACAC Primer-F TCAGACATTCACAATTGATTTTATTCTTAC Primer-R AAGATAGTTCCAAACATGTGCGAG IL-10 -1,082 G/A Probe-G TTCCCCCTCCCAAAG Probe-A TTCCCCTTCCCAAAGA Primer-F TCCATGGAGGCTGGATAGGA Primer-R CACACAAATCCAAGACAACACTACTAAG -819 C/T Probe-C TGTAACATCTCTGTGCCT Probe-T TGATGTAATATCTCTGTGCC Primer-F TTGGCACTGGTGTACCCTTGT Primer-R CCGTCTCTATTTTATAGTGAGCAAACTG -592 C/A Probe-C CGCCTGTCCTGTAGG Probe-A CGCCTGTTATGTAGGA Primer-F TGTGCCTGAGAATCCTAATGAAATC Primer-R CCCTTCCATTTTACTTTCCAGAGA TNF-α -308 G/A Probe-G AGGGGCATGGGGA Probe-A AGGGGCATGAGGAC Primer-F GAAATGGAGGCAATAGGTTTTGA Primer-R GGCCACTGACTGATTTGTGTGT TGF-β1 Codon 10 T/C Probe-T CTGCTGCTGCTGCTGCTACCG (-869) Probe-C CTGCTGCCGCTGCTGCTACC Primer-F CCACACCAGCCCTGTTCG Primer-R CCAGGCGTCAGCACCAGTA Codon 25 G/C Probe-G CCTGGCCGGCCGGC (-915) Probe-C CCTGGCCCGCCGGC Primer-F TTCCCTCGAGGCCCTCCTA Primer-R GCCGCAGCTTGGACAGGATC Cytokines Positions Genotypes No. (%) of persons Allele Frequency (%) INF-γ +874 AA 197 (82.1) A 91.0 AT 43 (17.9) T 9.0 IL-10 -1,082 AA 205 (85.4) A 92.7 AG 35 (14.6) G 7.3 -819 TT 108 (45.0) T 69.6 TC 118 (29.2) C 30.4 CC 14 (5.8) -592 AA 108 (45.0) A 69.4 AC 117 (48.8) C 30.6 CC 15 (6.3) TNF-α -308 GG 217 (90.4) G 95.2 GA 23 (9.6) A 4.8 TGF-β1 Codon 10 (-869) TT 65 (27.1) T 54.6 TC 132 (55.0) C 45.4 CC 43 (17.9) Codon 25 (-915) GG 240 (100) G 100.0 Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
    300 ≤ EPG
    IHDD (-) (%) IHDD (+) (%) IHDD (-) (%) IHDD (+) (%) INF-γ 874 AA 90 (60.8) 58 (39.2) 22 (44.9) 27 (55.1)a AT 20 (60.6) 13 (39.4) 2 (20.0) 8 (80.0) A 60.8 39.2 42.6 57.4 T 60.6 39.4 20.0 80.0 IL-10 -1,082 AA 95 (61.3) 60 (38.7) 20 (40.0) 30 (60.0) AG 15 (57.7) 11 (42.3) 4 (44.4) 5 (55.6) A 61.0 39.0 40.4 59.6 G 57.7 42.3 44.4 55.6 -819 TT 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0) TC 51 (57.3) 38 (42.7) 9 (31.0) 20 (69.0) CC 5 (55.6) 4 (44.4) 3 (60.0) 2 (40.0) T 62.4 37.6 41.8 58.2 C 57.0 43.0 38.5 61.5 -592 AA 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0) AC 50 (56.8) 38 (43.2) 9 (31.0) 20 (69.0) CC 6 (60.0) 4 (40.0) 3 (60.0) 2 (40.0) A 62.2 37.8 41.8 58.2 C 57.4 42.6 38.5 61.5 TNF-α -308 GG 99 (60.7) 64 (39.3) 20 (37.0) 34 (63.0)b GA 11 (61.1) 7 (38.9) 4 (80.0) 1 (20.0) G 61.1 38.9 80.0 20.0 A 60.8 39.2 38.9 61.1 TGF-β1 Codon 10 TT 37 (68.5) 17 (31.5) 4 (36.4) 7 (63.6) (-869) TC 52 (56.5) 40 (43.5) 17 (42.5) 23 (57.5) CC 21 (60.0) 14 (40.0) 3 (37.5) 5 (62.5) T 63.0 37.0 40.3 59.7 C 58.0 42.0 41.1 58.9 Codon 25 GG 110 (60.8) 71 (39.2) 24 (40.7) 35 (59.3) (-915) G 100.0 100.0 100.0 100.0 Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
    300 ≤ EPG
    PDE (-) (%) PDE (+) (%) PDE (-) (%) PDE (+) (%) INF-γ 874 AA 87 (58.8) 61 (41.2) 26 (53.1) 23 (46.9) AT 23 (69.7) 10 (30.3) 3 (30.0) 7 (70.0) A 59.9 40.1 50.9 49.1 T 69.7 30.3 30.0 70.0 IL-10 -1,082 AA 92 (59.4) 63 (40.6) 26 (52.0) 24 (48.0) AG 18 (69.2) 8 (30.8) 3 (33.3) 6 (66.7) A 60.1 39.9 50.5 49.5 G 69.2 30.8 33.3 66.7 -819 TT 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0) TC 51 (57.3) 38 (42.7) 13 (44.8) 16 (55.2) CC 5 (55.6) 4 (44.4) 2 (40.0) 3 (60.0) T 62.4 37.6 51.9 48.1 C 57.0 43.0 43.6 56.4 -592 AA 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0) AC 50 (56.8) 38 (43.2) 13 (44.8) 16 (55.2) CC 6 (60.0) 4 (40.0) 2 (40.0) 3 (60.0) A 62.2 37.8 51.9 48.1 C 57.4 42.6 43.6 56.4 TNF-α -308 GG 99 (60.7) 64 (39.3) 26 (48.1) 28 (51.9) GA 11 (61.1) 7 (38.9) 3 (60.0) 2 (40.0) G 61.1 38.9 60.0 40.0 A 60.8 39.2 48.7 51.3 TGF-β1 Codon 10 TT 33 (61.1) 21 (38.9) 6 (54.5) 5 (45.5) (-869) TC 58 (63.0) 34 (37.0) 20 (50.0) 20 (50.0) CC 19 (54.3) 16 (45.7) 3 (37.5) 5 (62.5) T 62.0 38.0 51.6 48.4 C 59.3 40.7 46.4 53.6 Codon 25 GG 110 (60.8) 71 (39.2) 29 (49.2) 30 (50.8) (-915) G 100.0 100.0 100.0 100.0 IFN-γ and TNF-α genotypesa IHDD (-) IHDD (+)b OR (95% Cl) Group 1 : low producing 3 (75.0%) 1 (25.0%) 1.0 (reference)  IFN-γ low, TNF-α high (n = 4) Group 2 : moderate producing 20 (43.5%) 26 (56.5%) 3.9 (0.4-40.4)  IFN-γ intermediate, TNF-α high (n = 1)  IFN-γ low, TNF-α low (n = 45) Group 3 : high producing 1 (11.1%) 8 (88.9%) 24.0 (1.1-516.4)  IFN-γ intermediate, TNF-α low (n = 9) Total (n=59) 24 (40.7%) 35 (59.3%)
    Table 1. Probe and primer combinations for cytokine polymorphism analysis using TaqMan real-time PCR allelic discrimination assay
    Table 2. Genotype and allele frequencies of IFN-γ, IL-10, TNF-α and TGF-β1 genes in subjected population (n = 240)
    Table 3. Distribution of genotypes and alleles of 4 cytokines by EPG groups of Clonorchis sinensis in relation to intrahepatic duct dilatation (IHDD)

    P = 0.177 (OR = 3.3, 95% CI 0.6-17.0), AT vs AA;

    P = 0.148 (OR = 6.8, 95% CI 0.7 - 65.2), GG vs GA.

    Table 4. Distribution of genotypes and alleles of 4 cytokines between 2 EPG groups of Clonorchis sinensis in relation to periductal echogenicity (PDE)
    Table 5. Association of IFN-γ and TNF-α genotype combinations with intrahepatic duct dilatation (IHDD) in persons moderately infected with Clonorchis sinensis

    IFN-γ: intermediate producing genotype, +874AT; low producing, +874AA. TNF-α: high producing genotype -308GA; low producing, -308GG;

    Linear by linear association analysis (P = 0.022).

    OR, odds ratio; CI, confidence interval.