Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis

The Korean Journal of Parasitology 2009;47(2):145-151.
Published online: May 27, 2009

1Department of Parasitology and Tropical Medicine and Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 110-799, Korea.

2Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul 110-799, Korea.

3Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 135-710, Korea.

Corresponding author (hst@snu.ac.kr)
• Received: February 4, 2009   • Revised: April 2, 2009   • Accepted: April 7, 2009

Copyright © 2009 by The Korean Society for Parasitology

  • 8,170 Views
  • 69 Download
  • 3 Crossref
  • 4 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Risk Factors of Clonorchis sinensis Human Infections in Endemic Areas, Haman-Gun, Republic of Korea: A Case-Control Study
    Sang-Eun Lee, Hee-Eun Shin, Myoung-Ro Lee, Yang-Hee Kim, Shin-Hyeong Cho, Jung-Won Ju
    The Korean Journal of Parasitology.2020; 58(6): 647.     CrossRef
  • The impact of cytokine gene polymorphisms on Epstein–Barr virus infection outcome in pediatric liver transplant recipients
    Beata Kasztelewicz, Irena Jankowska, Joanna Pawłowska, Joanna Teisseyre, Katarzyna Dzierżanowska-Fangrat
    Journal of Clinical Virology.2012; 55(3): 226.     CrossRef
  • Clinical relevance of the interleukin 10 promoter polymorphisms in Chinese Han patients with major trauma: genetic association studies
    Ling Zeng, Wei Gu, Kehong Chen, Dongpo Jiang, Lianyang Zhang, Dingyuan Du, Ping Hu, Qing Liu, Suna Huang, Jianxin Jiang
    Critical Care.2009;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
Korean J Parasitol. 2009;47(2):145-151.   Published online May 27, 2009
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
Korean J Parasitol. 2009;47(2):145-151.   Published online May 27, 2009
Close
Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
Single Nucleotide Polymorphisms of Cytokine Genes are Associated with Fibrosis of the Intrahepatic Bile Duct Wall in Human Clonorchiasis
Cytokines Positions Sequences INF-γ +874 T/A Probe-T CAAAATCAAATCTCACACACA Probe-A CAAAATCAAATCACACACAC Primer-F TCAGACATTCACAATTGATTTTATTCTTAC Primer-R AAGATAGTTCCAAACATGTGCGAG IL-10 -1,082 G/A Probe-G TTCCCCCTCCCAAAG Probe-A TTCCCCTTCCCAAAGA Primer-F TCCATGGAGGCTGGATAGGA Primer-R CACACAAATCCAAGACAACACTACTAAG -819 C/T Probe-C TGTAACATCTCTGTGCCT Probe-T TGATGTAATATCTCTGTGCC Primer-F TTGGCACTGGTGTACCCTTGT Primer-R CCGTCTCTATTTTATAGTGAGCAAACTG -592 C/A Probe-C CGCCTGTCCTGTAGG Probe-A CGCCTGTTATGTAGGA Primer-F TGTGCCTGAGAATCCTAATGAAATC Primer-R CCCTTCCATTTTACTTTCCAGAGA TNF-α -308 G/A Probe-G AGGGGCATGGGGA Probe-A AGGGGCATGAGGAC Primer-F GAAATGGAGGCAATAGGTTTTGA Primer-R GGCCACTGACTGATTTGTGTGT TGF-β1 Codon 10 T/C Probe-T CTGCTGCTGCTGCTGCTACCG (-869) Probe-C CTGCTGCCGCTGCTGCTACC Primer-F CCACACCAGCCCTGTTCG Primer-R CCAGGCGTCAGCACCAGTA Codon 25 G/C Probe-G CCTGGCCGGCCGGC (-915) Probe-C CCTGGCCCGCCGGC Primer-F TTCCCTCGAGGCCCTCCTA Primer-R GCCGCAGCTTGGACAGGATC Cytokines Positions Genotypes No. (%) of persons Allele Frequency (%) INF-γ +874 AA 197 (82.1) A 91.0 AT 43 (17.9) T 9.0 IL-10 -1,082 AA 205 (85.4) A 92.7 AG 35 (14.6) G 7.3 -819 TT 108 (45.0) T 69.6 TC 118 (29.2) C 30.4 CC 14 (5.8) -592 AA 108 (45.0) A 69.4 AC 117 (48.8) C 30.6 CC 15 (6.3) TNF-α -308 GG 217 (90.4) G 95.2 GA 23 (9.6) A 4.8 TGF-β1 Codon 10 (-869) TT 65 (27.1) T 54.6 TC 132 (55.0) C 45.4 CC 43 (17.9) Codon 25 (-915) GG 240 (100) G 100.0 Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
300 ≤ EPG
IHDD (-) (%) IHDD (+) (%) IHDD (-) (%) IHDD (+) (%) INF-γ 874 AA 90 (60.8) 58 (39.2) 22 (44.9) 27 (55.1)a AT 20 (60.6) 13 (39.4) 2 (20.0) 8 (80.0) A 60.8 39.2 42.6 57.4 T 60.6 39.4 20.0 80.0 IL-10 -1,082 AA 95 (61.3) 60 (38.7) 20 (40.0) 30 (60.0) AG 15 (57.7) 11 (42.3) 4 (44.4) 5 (55.6) A 61.0 39.0 40.4 59.6 G 57.7 42.3 44.4 55.6 -819 TT 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0) TC 51 (57.3) 38 (42.7) 9 (31.0) 20 (69.0) CC 5 (55.6) 4 (44.4) 3 (60.0) 2 (40.0) T 62.4 37.6 41.8 58.2 C 57.0 43.0 38.5 61.5 -592 AA 54 (65.1) 29 (34.9) 12 (48.0) 13 (52.0) AC 50 (56.8) 38 (43.2) 9 (31.0) 20 (69.0) CC 6 (60.0) 4 (40.0) 3 (60.0) 2 (40.0) A 62.2 37.8 41.8 58.2 C 57.4 42.6 38.5 61.5 TNF-α -308 GG 99 (60.7) 64 (39.3) 20 (37.0) 34 (63.0)b GA 11 (61.1) 7 (38.9) 4 (80.0) 1 (20.0) G 61.1 38.9 80.0 20.0 A 60.8 39.2 38.9 61.1 TGF-β1 Codon 10 TT 37 (68.5) 17 (31.5) 4 (36.4) 7 (63.6) (-869) TC 52 (56.5) 40 (43.5) 17 (42.5) 23 (57.5) CC 21 (60.0) 14 (40.0) 3 (37.5) 5 (62.5) T 63.0 37.0 40.3 59.7 C 58.0 42.0 41.1 58.9 Codon 25 GG 110 (60.8) 71 (39.2) 24 (40.7) 35 (59.3) (-915) G 100.0 100.0 100.0 100.0 Cytokines Positions Genotypes & Alleles 0 ≤ EPG < 300
300 ≤ EPG
PDE (-) (%) PDE (+) (%) PDE (-) (%) PDE (+) (%) INF-γ 874 AA 87 (58.8) 61 (41.2) 26 (53.1) 23 (46.9) AT 23 (69.7) 10 (30.3) 3 (30.0) 7 (70.0) A 59.9 40.1 50.9 49.1 T 69.7 30.3 30.0 70.0 IL-10 -1,082 AA 92 (59.4) 63 (40.6) 26 (52.0) 24 (48.0) AG 18 (69.2) 8 (30.8) 3 (33.3) 6 (66.7) A 60.1 39.9 50.5 49.5 G 69.2 30.8 33.3 66.7 -819 TT 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0) TC 51 (57.3) 38 (42.7) 13 (44.8) 16 (55.2) CC 5 (55.6) 4 (44.4) 2 (40.0) 3 (60.0) T 62.4 37.6 51.9 48.1 C 57.0 43.0 43.6 56.4 -592 AA 54 (65.1) 29 (34.9) 14 (56.0) 11 (44.0) AC 50 (56.8) 38 (43.2) 13 (44.8) 16 (55.2) CC 6 (60.0) 4 (40.0) 2 (40.0) 3 (60.0) A 62.2 37.8 51.9 48.1 C 57.4 42.6 43.6 56.4 TNF-α -308 GG 99 (60.7) 64 (39.3) 26 (48.1) 28 (51.9) GA 11 (61.1) 7 (38.9) 3 (60.0) 2 (40.0) G 61.1 38.9 60.0 40.0 A 60.8 39.2 48.7 51.3 TGF-β1 Codon 10 TT 33 (61.1) 21 (38.9) 6 (54.5) 5 (45.5) (-869) TC 58 (63.0) 34 (37.0) 20 (50.0) 20 (50.0) CC 19 (54.3) 16 (45.7) 3 (37.5) 5 (62.5) T 62.0 38.0 51.6 48.4 C 59.3 40.7 46.4 53.6 Codon 25 GG 110 (60.8) 71 (39.2) 29 (49.2) 30 (50.8) (-915) G 100.0 100.0 100.0 100.0 IFN-γ and TNF-α genotypesa IHDD (-) IHDD (+)b OR (95% Cl) Group 1 : low producing 3 (75.0%) 1 (25.0%) 1.0 (reference)  IFN-γ low, TNF-α high (n = 4) Group 2 : moderate producing 20 (43.5%) 26 (56.5%) 3.9 (0.4-40.4)  IFN-γ intermediate, TNF-α high (n = 1)  IFN-γ low, TNF-α low (n = 45) Group 3 : high producing 1 (11.1%) 8 (88.9%) 24.0 (1.1-516.4)  IFN-γ intermediate, TNF-α low (n = 9) Total (n=59) 24 (40.7%) 35 (59.3%)
Table 1. Probe and primer combinations for cytokine polymorphism analysis using TaqMan real-time PCR allelic discrimination assay
Table 2. Genotype and allele frequencies of IFN-γ, IL-10, TNF-α and TGF-β1 genes in subjected population (n = 240)
Table 3. Distribution of genotypes and alleles of 4 cytokines by EPG groups of Clonorchis sinensis in relation to intrahepatic duct dilatation (IHDD)

P = 0.177 (OR = 3.3, 95% CI 0.6-17.0), AT vs AA;

P = 0.148 (OR = 6.8, 95% CI 0.7 - 65.2), GG vs GA.

Table 4. Distribution of genotypes and alleles of 4 cytokines between 2 EPG groups of Clonorchis sinensis in relation to periductal echogenicity (PDE)
Table 5. Association of IFN-γ and TNF-α genotype combinations with intrahepatic duct dilatation (IHDD) in persons moderately infected with Clonorchis sinensis

IFN-γ: intermediate producing genotype, +874AT; low producing, +874AA. TNF-α: high producing genotype -308GA; low producing, -308GG;

Linear by linear association analysis (P = 0.022).

OR, odds ratio; CI, confidence interval.