Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Screening and Molecular Cloning of a Protective Antigen from the Midgut of Haemaphysalis longicornis

The Korean Journal of Parasitology 2013;51(3):327-334.
Published online: June 30, 2013

1Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University, Shijiazhuang 050024, China.

2Shijiazhuang Post and Telecommunication Technical College, Shijiazhuang 050021, China.

Corresponding author (jzliu21@heinfo.net)
• Received: January 23, 2013   • Revised: April 24, 2013   • Accepted: April 25, 2013

© 2013, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,397 Views
  • 69 Download
  • 6 Crossref
  • 6 Scopus
prev next
  • Vaccination is considered a promising alternative for controlling tick infestations. Haemaphysalis longicornis midgut proteins separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membrane were screened for protective value against bites. The western blot demonstrated the immunogenicity of 92 kDa protein (P92). The analysis of the P92 amino acid sequence by LC-MS/MS indicated that it was a H. longicornis paramyosin (Hl-Pmy). The full lenghth cDNA of Hl-Pmy was obtained by rapid amplification of cDNA ends (RACE) which consisted of 2,783 bp with a 161 bp 3' untranslated region. Sequence alignment of tick paramyosin (Pmy) showed that Hl-Pmy shared a high level of conservation among ticks. Comparison with the protective epitope sequence of other invertebrate Pmy, it was calculated that the protective epitope of Hl-Pmy was a peptide (LEEAEGSSETVVEMNKKRDTE) named LEE, which was close to the N-terminal of Hl-Pmy protein. The secondary structure analysis suggested that LEE had non-helical segments within an α-helical structure. These results provide the basis for developing a vaccine against biting H. longicornis ticks.
Ticks are obligate hematophagous ectoparasites and transmit many pathogens, affecting human and animal health [1]. Tick control is dependent on the application of acaricides. Because ticks have developed resistance to acaricides where they have been used extensively, and application contributes to environmental contamination and exposure of non-target organisms [2,3], alternative tick control measures are needed. In the early 1990s, it was shown that the Bm86 gut antigen of Rhipicephalus (Boophilus) microplus could induce immunological protection to hosts, protecting them against tick infestations [4]. Subsequently, 2 vaccines (Gavac and TickGARD) based on the recombinant R. microplus Bm86 gut antigen were verified to be effective in field trials and registered in Latin American countries and Australia [5,6]. Vaccination against R. microplus infestations is considered as an efficient alternative for tick control, while concurrently reducing the use of acaricides [7,8].
Haemaphysalis longicornis is widely distributed in China, New Zealand, Korea, Japan, and Australia [9], and is a vector of zoonotic pathogens, including Theileria sergenti, Babesia ovata, and Rickettsia japonica [10,11], that impact negatively on human and animal health. More recently in 2009, severe fever with thrombocytopenia syndrome (SFTS) was reported in Hubei and Henan provinces of China. Later a novel bunyavirus was isolated from patients, and H. longicornis may be a candidate vector [12]. While several vaccine candidates, such as extracellular matrix protein p29 [7], serine protease inhibitor serpin [13], troponin I-like protein P27/30 [14], and heat shock protein HLHsp70 [15], have been evaluated for control of H. longicornis, immunized rabbits showed partial or no protection against biting ticks. Thus, the search for new antigen candidates for the development of an effective vaccine is necessary.
Midgut antigens on the luminal surface are directly exposed to the blood meal and host immune effectors, and are promising targets for the development of effective vaccines [16]. In this study, we screened the 92 kDa protein (P92) by polyclonal antibody from H. longicornis midguts and analyzed the amino acid sequences of P92 using the LC-MS/MS. The results showed that the protective antigen may be a paramyosin. By a rapid amplification of cDNA ends (RACE), we cloned the P92 gene and predicted its protective epitope.
Tick and tissue collection
H. longicornis were carefully removed from infested sheep in the Xiaowutai National Natural Reserve Area of Hebei Province, China, using forceps, placed in glass tubes, and transported to our laboratory at Hebei Normal University where they were fed on the ears of rabbits. The rabbits were maintained in cages designed for collecting detached ticks at 25-27℃ and 50% relative humidity (RH). After detachment, ticks were collected and maintained in cotton-plugged glass tubes filled with 1 folded filter paper in an incubator at 25±1℃ and 75% RH.
Midguts of unfed females were dissected in cold 0.1 M PBS (pH 7.2) solution under a microscope using forceps. Dissected midguts were washed 3 times with PBS and placed in 2 ml eppendorf tubes containing 0.5 ml 0.1 M PBS, and stored at -80℃ for later analysis.
Generation of rabbit anti-tick midgut serum
Polyclonal antibodies against midguts were generated in adult male New Zealand white rabbits purchased from the Hebei Laboratory Animal Center (Shijiazhuang, China). The rabbits were initially injected with 360 µg midgut extract emulsified in an equal volume of Freund's complete adjuvant. Two additional injections were given every 2 weeks with 360 µg antigen emulsified with an equal volume of Freund's incomplete adjuvant. One week after the third injection, blood was collected from the carotid artery of rabbits and serum was assayed to determine antibody titers through indirect ELISA.
SDS-PAGE and western blot
A total of 80 midguts from unfed female ticks were ground in cold 0.1 M PBS solution using a homogenizer, placed in 2 ml eppendorf tubes, and centrifuged at 10,000 rpm for 30 min at 4℃. A total of 30 µg protein per lane were separated by 14% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane. Subsequently, the membrane was cut into 3 strips and the protein marker strip was dyed by amido black. The other 2 strips of midgut proteins were blocked for 2 hr in PBS-Tween-20 (PBST) containing 5% fat-free milk, then incubated in rabbit negative serum and rabbit anti-tick midgut serum (1:8) overnight at room temperature, respectively. The strips were then washed 3 times with PBST and incubated with diluted peroxidase-conjugated sheep anti-rabbit IgG (1:1,000) for 1.5 hr. Positive signals of coloration were detected using 3,3-diaminobenzidine and hydrogen peroxide.
LC-MS/MS analysis
To analyze the P92 amino acid sequence, a 15 µg midgut protein from unfed female ticks was electrophoresed on a 12% SDS-PAGE gel and then stained with Commassie blue. Based on the molecular weight marker, the 92 kDa protein band was cut and placed into 2 ml eppendorf tubes. This was followed by reduction with DL-dithiothreitol (DTT), alkylation with iodoacetamide, and digestion with trypsin. Subsequently, samples were separated on a C18 reverse phase column (100 µm ID×15 cm length, 5 µm particle size, 300 Å pore size) (BioBasic, Thermo Fisher Scientific, Rockford, Illinois, USA) at a flow rate of 400 nl/min. Peptides were eluted using a linear acetonitrile gradient (0-80%) solvent B (solvent A: 100% H2O + 0.1% formic acid; solvent B: 100% acetonitrile + 0.1% formic acid) for 60 min using a nano LC system (Thermo Fisher Scientific). Eluted peptides were directly electrosprayed (from an uncoated 15 µm-inner diameter-spraying needle) into an LTQ linear ion trap mass spectrometer (Thermo Fisher Scientific) using a nano-ESI emitter with a 2.0 kV electrospray voltage, and mass spectrometer capillary transfer temperature was set at 200℃. LC-MS/MS data were acquired in a data-dependent acquisition controlled by Xcalibur 2.0 software. Full MS scans in the m/z range of 400-2,000 were followed by 10 data dependent MS/MS scans acquired in the linear ion trap by collision induced dissociation (CID) with 35% normalized collision energy. Proteins were identified using SEQUEST in Bioworks 3.3.1 software package against tick protein databases (July 22, 2012) in NCBI.
RNA preparation
Total RNA was extracted from the midguts using an RNA purification kit (Axygen, Union City, California, USA) according to the manufacture's instructions. After determining the concentrations of RNA samples by measuring the absorbance at 260 nm, the samples were stored at -80℃ for later analysis. Quality of the total RNA was analyzed by agarose (Novagen, Darmstadt, Germany) gel electrophoresis.
Amplification and sequencing of cDNA fragments
To sequence the H. longicornis paramyosin (Hl-Pmy) cDNA fragments, 2 µg of total RNA was reverse-transcribed using a cDNA synthesis kit (ThermoScript RT-PCR system, Invitrogen, Carlsbad, California, USA) according to the manufacturer's protocol. The forward primer Para-1 and reverse primer Anti-1 (Sangon, Shanghai, China) were designed based on the paramyosin sequence of R. microplus (GenBank accession no. AF47 9582) from the Shanghai Sangon Company (Table 1). Amplification of Hl-Pmy cDNA fragments was performed by PCR at 94℃ for 5 min, followed by 30 cycles of 94℃ for 50 sec, 55℃ for 50 sec, 72℃ for 1 min, and a final extension for 10 min at 72℃.
PCR products were purified using the agarose gel extraction kit (Axygen), ligated into the pMD19-T cloning vector (Takara, Ohtsu, Japan), and transformed into DH5α competent cells. Positive clones were selected for PCR under the above cited conditions and 3 independent positive clones verified by PCR were sequenced by Takara Company to confirm that no mutation or error had occurred.
Rapid amplification of cDNA ends
Total RNA of the midguts was used as the template to synthesize the first strand cDNA using an oligo dT-adaptor primer adaptor (Table 1). Reverse-transcribed products were used as a template to amplify the 3' end of the Hl-Pmy cDNA using FP-para2 and AP (Sangon, Shanghai, China) primers (Table 1). PCR cycling conditions were 94℃ for 5 min, followed by 30 cycles of 94℃ for 30 sec, 52℃ for 30 sec, 72℃ for 2 min, and a final elongation at 72℃ for 10 min. The obtained PCR products were subcloned into the pMD19-T vector (Takara) for sequencing.
HBS1 and HBX1 were used as primers to amplify the 5' end of Hl-Pmy cDNA (Table 1). The reaction parameters were as follows: 3 min denaturation at 95℃, followed by 30 cycles of 95℃ for 30 sec, 62℃ for 1 min, 72℃ for 3 min, and a final extension at 72℃ for 10 min. The obtained PCR products were subcloned into the pMD19-T vector (Takara) for sequencing.
Sequencing analysis and protective epitope prediction
Nucleotide sequences were analyzed using the DNAMAN software. Protein sequences of paramyosin in ticks and the protective epitope (YX1, SP2) of paramyosin found in other invertebrates [17,18] were aligned using the Clustal X, and the output of the graphic file was obtained using the DNAMAN software. Protein secondary structure prediction was done at the website (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NP-SA/npsa_server.html) using the DSC algorithm [19].
Protective antigen detection in the tick midgut by western blot
Reactivities of both rabbit negative serum and rabbit anti-H. longicornis midgut serum with midgut proteins were used to screen the protective antigen of the midgut by western blot. Only 92 kDa and 66 kDa protein bands were recognized by rabbit anti-H. longicornis midgut serum, while the rabbit negative serum did not react with the female tick midgut proteins (Fig. 1). These data suggest that the 92 kDa and 66 kDa proteins had immunogenic properties that might be useful in vaccine development.
LC-MS/MS analysis
The 92 kDa protein (P92) was excised from Commassie-stained SDS-PAGE gel (Fig. 2) and analyzed by LC-MS/MS. The results showed that the amino acid sequence of 12 peptides derived from P92 matched the paramyosin (Pmy) amino acid sequence of R. microplus (Table 2). These results showed that the P92 may be the H. longicornis paramyosin (Hl-Pmy).
Sequencing and characterization of a cDNA encoding Hl-Pmy
The Hl-Pmy cDNA sequence was obtained by 3' and 5' RACE using the primers shown in Table 1 and GenBank accession no. is JQ517315. The full-length of the Hl-Pmy cDNA consisted of 2,783 bp with a 161 bp 3'-untranslated region, and included a polyadenylation signal (AATAAA) and a poly (A) tail (Fig. 3). The open-reading frames (ORF) were 2,622 bp, which encoded for 873 amino acid residues.
Sequences alignment and protective epitope prediction
Only 2 tick Pmy sequences were obtained from sequence data in NCBI, including R. microplus (GenBank no. AAO20875) and Ixodes scapularis (GenBank no. XP_002407289). The comparison results showed that the amino acid sequence of Hl-Pmy (GenBank no. AFR32950) shared 97% identity and 99% similarity with R. microplus Pmy, and 94% identity and 97% similarity with I. scapularis Pmy (Fig. 4).
Amino acid sequences of Hl-Pmy were compared with Pmy epitope YX1 (EEAEGTTDAQIDANRKRESE) of Trichinella spiralis and SP2 (LDELSGTSS-QTHDAIRRKDME) of Taenia solium using the Clustal X (Fig. 4). The results indicated that the protective epitope of Hl-Pmy was close to the N-terminal of Hl-Pmy protein, as the LEE peptide (LEEAEGSSETVVEMNKKRDTE) (boxed in Figs. 3, 5). The Hl-Pmy secondary structure was predicted by DSC algorithm (Fig. 5) and the LEE peptide was found to have a non-helical segment within an α-helical structure.
Tick midgut proteins are considered to be concealed antigens, that have immunomodulatory effects [8], and have been more recently exploited as targets for vaccine development [20,21]. By western blot analysis, 5 midgut membrane antigens from Hyalomma anatolicum anatolicum with molecular weight 95, 85, 66, 49, and 42 kDa have been identified [22]. In addition, several candidate proteins, such as Kunitz-type proteinase inhibitor [20], thrombin inhibitor hemalin [23], and a homolog of the Ser/Thr kinase Akt (HlAkt) [24], have been reported as protective antigens from H. longicornis. Their molecular weights were 12, 20, and 60 kDa, respectively. In this study, 2 proteins (92 and 66 kDa) from H. longicornis midguts that demonstrated immunogenicity were identified (Fig. 1). The results of LC-MS/MS showed that the 12 peptide amino acid sequences of antigen P92 matched with the Pmy of R. microplus (Table 2), suggesting that P92 is the Pmy observed in H. longicornis.
Pmy is a myofibrillar protein with a coiled-coil structure found exclusively in invertebrates [25]. Vertebrates don't have homologous Pmy and antibodies produced by immunization with Pmy can't induce autoimmune responses in vertebrates. Thus, Pmy is a good candidate antigen for developing a vaccine, and has been identified and characterized in a variety of parasites, including Schistosoma japonicum [26], T. solium [27], and Taenia saginata [28]. However, few studies of Pmy have been reported in ticks. Only R. microplus Pmy sequence has been previously reported, which encoded a cDNA fragment with an open reading frame of 873 amino acids [29]. Furthermore, the amino acid sequence of H. longicornis Hl-Pmy demonstrated a high degree of identity to R. microplus Pmy. In addtion, the predicted molecular weight for Hl-Pmy was 92 kDa (Fig. 1), which was similar to the values observed for most Pmy proteins [30]. Sequence and structural analyses showed that Hl-Pmy is a Pmy protein, and the predicted secondary structure is a coiled-coil shape consistent with the characteristics of Pmy proteins [18].
Multiple alignment showed a high degree of conservation among tick Pmy proteins, including H. longicornis, R. microplus, and I. scapularis (Fig. 4), with similarities greater than 97%. This indicates that Pmy is a conservative protein with little variation among different tick species. Furthermore, the deduced sequence of R. microplus Pmy also demonstrated a high similarity with the full length Pmy sequences from other invertebrates, such as Onchocerca volvulus, Brugia malayi, Sarcoptes scabiei, and Drosophila melanogaster [29]. This suggests that Pmy is widely distributed and highly conservative among invertebrates. In addition to being a structural protein, Pmy is also an immunomodulatory protein that plays an important role in host-parasite interactions during helminth infections [31]. The potential of Pmy proteins as a vaccine candidate against schistosomiasis has been demonstrated [26]. Among ticks, only the recombinant Pmy protein of R. microplus has been shown to bind both IgG and collagen [29]. This reflects the potential importance of Pmy proteins in functions related to host immune system evasion. Thus, it is necessary to analyze the function of tick Pmy proteins in immunization studies.
To improve the immune efficiency of Pmy, a monoclonal antibody 7E2 was used to screen a random phage-displayed peptide library, and it was confirmed that amino acid regions 88-107 of T. spiralis Pmy was the epitope region named YX1 [17]. Studies showed that mice immunized with KLH-conjugated YX1 protected against T. spiralis larval challenge. Gazarian et al. [18] used synthetic peptides to induce rabbit antibody responses for phage-display mapping of epitopes and found that the non-helical segment SP2 of T. solium Pmy was a much better antigen than the α-helical segment SP1. By analysis of multiple alignment results (Fig. 4), we speculated that the peptide LEE was the protective epitope for Hl-Pmy. Secondary structure prediction showed a short non-helical segment in the α-helical structure of LEE (Fig. 5). These characteristics were consistent with that of SP2. Our results provide the basis for future studies on immunization with Hl-Pmy or LEE to prevent attachment of H. longicornis tick to target vertebrate hosts.
This work was supported by Natural Science Foundation of Hebei Province (Grant No. C2011205104), Project of Education Department of Hebei Province (Grant No. 2011160), and the Foundation of Hebei Normal University (No. L2012Z06 and No. L2008B10).
  • 1. Ahmed J, Alp H, Aksin M, Seitzer U. Current status of ticks in Asia. Parasitol Res 2007;101:S159-S162.
  • 2. Riding GA, Jarmey J, Mckenna RV, Pearson R, Cobon GS, Willadsen P. A protective "concealed" antigen from Boophilus microplus. Purification, localization, and possible function. J Immunol 1994;153:5158-5166.
  • 3. Davey RB, George JE, Miller RJ. Comparison of the reproductive biology between acaricide-resistant and acaricide-susceptible Rhipicephalus (Boophilus) microplus (Acari: Ixodidae). Vet Parasitol 2006;139:211-220.
  • 4. Willadsen P, Riding GA, Mckenna RV, Kemp DH, Tellam RL, Nielsen JN, Lahnstein J, Cobon GS, Gough JM. Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus. J Immunol 1989;143:1346-1351.
  • 5. De La Fuente J, Rodriguez M, Montero C, Redondo M, Garcia-Garcia JC, Méndez L, Serrano E, Valdés M, Enríquez A, Canales M, Ramos E, Boué O, Machado H, Lleonart R. Vaccination against ticks (Boophilus spp.): the experience with the Bm86-based vaccine Gavac. Genet Anal 1999;15:143-148.
  • 6. Jonsson NN, Matschoss AL, Pepper P, Green PE, Albrecht MS, Hungerford J, Ansell J. Evaluation of tickGARDPLUS, a novel vaccine against Boophilus microplus, in lactating Holstein Friesian cows. Vet Parasitol 2000;88:275-285.
  • 7. Mulenga A, Sugimoto C, Sako Y, Ohashi K, Musoke A, Shubash M, Onuma M. Molecular characterization of a Haemaphysalis longicornis tick salivary gland-associated 29-kilodalton protein and its effect as a vaccine against tick infestation in rabbits. Infect Immun 1999;67:1652-1658.
  • 8. Nuttall PA, Trimnell AR, Kazimirova M, Labuda M. Exposed and concealed antigens as vaccine targets for controlling ticks and tick-borne diseases. Parasite Immunol 2006;28:155-163.
  • 9. Zheng H, Yu Z, Zhou L, Yang X, Liu J. Seasonal abundance and activity of the hard tick Haemaphysalis longicornis (Acari: Ixodidae) in North China. Exp Appl Acarol 2012;56:133-141.
  • 10. Bai Q, Liu G, Han G. Developing-morphological observations on Babesia ovata in engorged females Haemaphysalis longicornis and its eggs. Sci Agric Sin 1996;29:89-92.
  • 11. Jongejan F, Uilenberg G. The global importance of ticks. Parasitology 2004;129:S3-S14.
  • 12. Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, Zhang L, Zhang QF, Popov VL, Li C, Qu J, Li Q, Zhang YP, Hai R, Wu W, Wang Q, Zhan FX, Wang XJ, Kan B, Wang SW, Wan KL, Jing HQ, Lu JX, Yin WW, Zhou H, Guan XH, Liu JF, Bi ZQ, Liu GH, Ren J, Wang H, Zhao Z, Song JD, He JR, Wan T, Zhang JS, Fu XP, Sun LN, Dong XP, Feng ZJ, Yang WZ, Hong T, Zhang Y, Walker DH, Wang Y, Li DX. Fever with Thrombocytopenia Associated with a Novel Bunyavirus in China. N Engl J Med 2011;364:1523-1532.
  • 13. Imamura S, da Silva Vaz Junior I, Sugino M, Ohashi K, Onuma M. A serine protease inhibitor (serpin) from Haemaphysalis longicornis as an anti-tick vaccine. Vaccine 2005;23:1301-1311.
  • 14. You MJ. Immunization of mice with recombinant P27/30 protein confers protection against hard tick Haemaphysalis longicornis (Acari: Ixodidae) infestation. J Vet Sci 2005;6:47-51.
  • 15. Tian Z, Liu G, Zhang L, Yin H, Wang H, Xie J, Zhang P, Luo J. Identification of the heat shock protein 70 (HLHsp70) in Haemaphysalis longicornis. Vet Parasitol 2011;181:282-290.
  • 16. Rachinsky A, Guerrero FD, Scoles GA. Proteomic profiling of Rhipicephalus (Boophilus) microplus midgut responses to infection with Babesia bovis. Vet Parasitol 2008;152:294-313.
  • 17. Wei J, Gu Y, Yang J, Yang Y, Wang S, Cui S, Zhu X. Identification and characterization of protective epitope of Trichinella spiralis paramyosin. Vaccine 2011;29:3162-3168.
  • 18. Gazarian KG, Solis CF, Gazarian TG, Rowley M, Laclette JP. Synthetic peptide-targeted selection of phage display mimotopes highlights immunogenic features of α-helical vs non-helical epitopes of Taenia solium paramyosin: implications for parasite- and host-protective roles of the protein. Peptides 2012;34:232-241.
  • 19. King RD, Sternberg MJ. Identification and application of the concepts important for accurate and reliable protein secondary structure prediction. Protein Sci 1996;5:2298-2310.
  • 20. Miyoshi T, Tsuji N, Islam MK, Alim MA, Hatta T, Yamaji K, Anisuzzaman , Fujisaki K. A Kunitz-type proteinase inhibitor from the midgut of the ixodid tick, Haemaphysalis longicornis, and its endogenous target serine proteinase. Mol Biochem Parasitol 2010;170:112-115.
  • 21. Soares TS, Watanabe RM, Tanaka-Azevedo AM, Torquato RJ, Lu S, Figueiredo AC, Pereira PJ, Tanaka AS. Expression and functional characterization of boophilin, a thrombin inhibitor from Rhipicephalus (Boophilus) microplus midgut. Vet Parasitol 2012;187:521-528.
  • 22. Madani R, Golchinfar F, Dadmehr A, Abdigoudarzi M. Preparation of antigens from midgut of Hyalomma anatolicum anatolicum and determining their immunoprotective effects. Arch Razi Inst 2009;63:47-52.
  • 23. Liao M, Zhou J, Gong H, Boldbaatar D, Shirafuji R, Battur B, Nishikawa Y, Fujisaki K. Hemalin, a thrombin inhibitor isolated from a midgut cDNA library from the hard tick Haemaphysalis longicornis. J Insect Physiol 2009;55:164-173.
  • 24. Umemiya-Shirafuji R, Tanaka T, Boldbaatar D, Tanaka T, Fujisaki K. Akt is an essential player in regulating cell/organ growth at the adult stage in the hard tick Haemaphysalis longicornis. Insect Biochem Mol Biol 2012;42:164-173.
  • 25. Zhang DM, Pan WQ, Qian L, Duke M, Shen LH, McManus DP. Investigation of recombinant Schistosoma japonicum paramyosin fragments for immunogenicity and vaccine efficacy in mice. Parasite Immunol 2006;28:77-84.
  • 26. Zhou S, Liu S, Song G, Xu Y, Sun W. Protective immunity induced by the full length cDNA encoding paramyosin of Chinese Schistosoma japonicum. Vaccine 2000;18:3196-3204.
  • 27. Vázquez-Talavera J, Solís CF, Terrazas LI, Laclette JP. Characterization and protective potential of the immune response to Taenia solium paramyosin in a murine model of cysticercosis. Infect Immun 2001;69:5412-5416.
  • 28. Ferrer E, Moyano E, Benitez L, González LM, Bryce D, Foster-Cuevas M, Dávila I, Cortéz MM, Harrison LJ, Parkhouse RM, Gárate T. Cloning and characterization of Taenia saginata paramyosin cDNA. Parasitol Res 2003;91:60-67.
  • 29. Ferreira CA, Barbosa MC, Silveira TC, Valenzuela JG, Vaz Ida S Jr, Masuda A. cDNA cloning, expression and characterization of a Boophilus microplus paramyosin. Parasitology 2002;125:265-274.
  • 30. Maroto M, Arredondo JJ, San Román M, Marco R, Cervera M. Analysis of the paramyosin/miniparamyosin gene. Miniparamyosin is an independently transcribed, distinct paramyosin isoform, widely distributed in invertebrates. J Biol Chem 1995;270:4375-4382.
  • 31. Deng J, Gold D, LoVerde PT, Fishelson Z. Inhibition of the complement membrane attack complex by Schistosoma mansoni paramyosin. Infect Immun 2003;71:6402-6410.
Fig. 1
Western blot of midgut antigens from H. longicornis. M, molecular weight marker stained by amido black; Lane 1, midgut antigens incubated by rabbit negative serum; Lane 2, midgut antigens incubated by rabbit anti-H. longicornis midgut serum.
kjp-51-327-g001.jpg
Fig. 2
SDS-PAGE analysis of midgut antigens of H. longicornis. M, molecular weight marker; Lane 1, midgut antigens of H. longicornis. The 92kDa protein (arrow) was cut for LC-MS/MS analysis.
kjp-51-327-g002.jpg
Fig. 3
Nucleic acid and deduced amino acid sequences of Hl-Pmy. The start codon and polyadenylation signal are underlined respectively; the stop codon is marked with an asterisk. Light black shaded area indicates the peptides identified by LC-MS/MS. The predicted protective epitopes are boxed.
kjp-51-327-g003.jpg
Fig. 4
Multiple alignment of paramyosin sequences in ticks and protective epitope of paramyosin in other invertebrates. Genbank accession numbers: Ixodes scapularis, XP_002407289; Rhipicephalus microplus, AAO20875; Haemaphysalis longicornis (Hl-Pmy), AFR32950. YX1, protective epitope (EEAEGTTDAQIDANRKRESE) of Trichinella spiralis; SP2, protective epitope (LDELSGTSSQTHDAIRRKDME) of Taenia solium. Dark black shade shows identity and light black shade shows residues conserved in 4/5 sequences.
kjp-51-327-g004.jpg
Fig. 5
The predicted secondary structure for Hl-Pmy by using DSC algorithm. h, alpha helix; c, random coil; e, extended strand. The predicted protective epitope of Hl-Pmy are boxed.
kjp-51-327-g005.jpg
Table 1.
Primer pairs used for Hl-Pmy cDNA amplification by PCR
Table 1.
Category Primer name Sequencea
Hl-Pmy fragment Para-1 AGGTGCTCATTATGGACTTG
Anti-1 TTGGCTTCCTCCTGCTT
3´ RACE Adaptor GTTTTCCCAGTCACGACT(15)
AP GTTTTCCCAGTCACGAC
FP-para2 ACGGGATGGAGATCAA
5´ RACE HBS1 ATGTCTAGCAGGAGGAGCAAGTAT
HBX1 ACTTGAGGTCGATGTTGAGCTTCT

aThe orientation of the primer is from 5´ end to 3´ end.

Table 2
Peptides of P92 identified by LC-MS/MS from H. longicornis midguts
Table 2
Peptide Sequence MH+
-.STKDILVEEQER.- 1446.7434
-.AKELLLQTEEDHK.- 1553.8169
-.VSLDNVNHLK.- 1138.6214
-.LEEVEANALAGGKR.- 1456.7754
-.RLENERDELAAAYK.- 1677.8554
-.RCQGLQAELDEQR.- 1602.7653
-.QLQQCADQLAISQR.- 1658.8279
-.NKLESELSALQADYDELHK.- 2203.0877
-.ISEYEEQLEALLTR.- 1693.8643
-.FQAEVYELLAQVENTNK.- 1996.0022
-.VNELTTINVNIAAAK.- 1570.8799
-.SSGGAGDISIEYGTDLGALTR.- 2039.9880

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Screening and Molecular Cloning of a Protective Antigen from the Midgut of Haemaphysalis longicornis
Korean J Parasitol. 2013;51(3):327-334.   Published online June 30, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Screening and Molecular Cloning of a Protective Antigen from the Midgut of Haemaphysalis longicornis
Korean J Parasitol. 2013;51(3):327-334.   Published online June 30, 2013
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Screening and Molecular Cloning of a Protective Antigen from the Midgut of Haemaphysalis longicornis
Image Image Image Image Image
Fig. 1 Western blot of midgut antigens from H. longicornis. M, molecular weight marker stained by amido black; Lane 1, midgut antigens incubated by rabbit negative serum; Lane 2, midgut antigens incubated by rabbit anti-H. longicornis midgut serum.
Fig. 2 SDS-PAGE analysis of midgut antigens of H. longicornis. M, molecular weight marker; Lane 1, midgut antigens of H. longicornis. The 92kDa protein (arrow) was cut for LC-MS/MS analysis.
Fig. 3 Nucleic acid and deduced amino acid sequences of Hl-Pmy. The start codon and polyadenylation signal are underlined respectively; the stop codon is marked with an asterisk. Light black shaded area indicates the peptides identified by LC-MS/MS. The predicted protective epitopes are boxed.
Fig. 4 Multiple alignment of paramyosin sequences in ticks and protective epitope of paramyosin in other invertebrates. Genbank accession numbers: Ixodes scapularis, XP_002407289; Rhipicephalus microplus, AAO20875; Haemaphysalis longicornis (Hl-Pmy), AFR32950. YX1, protective epitope (EEAEGTTDAQIDANRKRESE) of Trichinella spiralis; SP2, protective epitope (LDELSGTSSQTHDAIRRKDME) of Taenia solium. Dark black shade shows identity and light black shade shows residues conserved in 4/5 sequences.
Fig. 5 The predicted secondary structure for Hl-Pmy by using DSC algorithm. h, alpha helix; c, random coil; e, extended strand. The predicted protective epitope of Hl-Pmy are boxed.
Screening and Molecular Cloning of a Protective Antigen from the Midgut of Haemaphysalis longicornis
Category Primer name Sequencea Hl-Pmy fragment Para-1 AGGTGCTCATTATGGACTTG Anti-1 TTGGCTTCCTCCTGCTT 3´ RACE Adaptor GTTTTCCCAGTCACGACT(15) AP GTTTTCCCAGTCACGAC FP-para2 ACGGGATGGAGATCAA 5´ RACE HBS1 ATGTCTAGCAGGAGGAGCAAGTAT HBX1 ACTTGAGGTCGATGTTGAGCTTCT Peptide Sequence MH+ -.STKDILVEEQER.- 1446.7434 -.AKELLLQTEEDHK.- 1553.8169 -.VSLDNVNHLK.- 1138.6214 -.LEEVEANALAGGKR.- 1456.7754 -.RLENERDELAAAYK.- 1677.8554 -.RCQGLQAELDEQR.- 1602.7653 -.QLQQCADQLAISQR.- 1658.8279 -.NKLESELSALQADYDELHK.- 2203.0877 -.ISEYEEQLEALLTR.- 1693.8643 -.FQAEVYELLAQVENTNK.- 1996.0022 -.VNELTTINVNIAAAK.- 1570.8799 -.SSGGAGDISIEYGTDLGALTR.- 2039.9880
Table 1. Primer pairs used for Hl-Pmy cDNA amplification by PCR

The orientation of the primer is from 5´ end to 3´ end.

Table 2 Peptides of P92 identified by LC-MS/MS from H. longicornis midguts