Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Modulation of Antibody Responses against Gnathostoma spinigerum in Mice Immunized with Crude Antigen Formulated in CpG Oligonucleotide and Montanide ISA720

The Korean Journal of Parasitology 2013;51(6):637-644.
Published online: December 31, 2013

1Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand.

2Research and Diagnostic Center for Emerging Infectious Diseases, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand.

3Department of Microbiology, Faculty of Public Health, Mahidol University, Bangkok 10400, Thailand.

4Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand.

Corresponding author (pewpan@kku.ac.th)
• Received: May 30, 2013   • Revised: August 7, 2013   • Accepted: October 11, 2013

© 2013, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 9,417 Views
  • 86 Download
  • 1 Crossref
  • 1 Scopus
prev next
  • This study aimed to investigate the antibody responses in mice immunized with Gnathostoma spinigerum crude antigen (GsAg) incorporated with the combined adjuvant, a synthetic oligonucleotide containing unmethylated CpG motif (CpG ODN 1826) and a stable water in oil emulsion (Montanide ISA720). Mice immunized with GsAg and combined adjuvant produced all antibody classes and subclasses to GsAg except IgA. IgG2a/2b/3 but not IgG1 subclasses were enhanced by immunization with CpG ODN 1826 when compared with the control groups immunized with non-CpG ODN and Montanide ISA or only with Montanide ISA, suggesting a biased induction of a Th1-type response by CpG ODN. After challenge infection with live G. spinigerum larvae, the levels of IgG2a/2b/3 antibody subclasses decreased immediately and continuously, while the IgG1 subclass remained at high levels. This also corresponded to a continuous decrease of the IgG2a/IgG1 ratio after infection. Only IgM and IgG1 antibodies, but not IgG2a/2b/3, were significantly produced in adjuvant control groups after infection. These findings suggest that G. spinigerum infection potently induces a Th2-type biased response.
Gnathostoma spinigerum is a nematode parasite, of which larvae cause gnathostomiasis in humans and certain animals, and is prevalent mainly in Asia [1,2]. Recently, human gnathostomiasis has become an emerging disease among travellers from western countries who visit endemic areas [3,4]. Human beings are accidental hosts, infected by consuming raw or semi-cooked foods that are contaminated with the infective larvae. The parasite rarely develops into a mature worm in humans but can survive for a long time in the body. It usually migrates into the subcutaneous tissue and causes intermittent migratory swellings [5]. Sometimes Gnathostoma larvae reach the central nervous system, resulting in various signs and symptoms that may be life-threatening [6-9]. The anthelmintic drug, albendazole, has been used for the treatment of gnathostomiasis [10]. However, the efficacy of this drug treatment is not very satisfactory and frequent failure was reported after a long term follow-up study [11]. Therefore, vaccine development is an alternative approach for prevention and control of this disease.
Although strong antibody responses are induced by infection with G. spinigerum in humans and mice [12-17], protective immunity against challenge infection with the same parasite species remains unclear. This suggests that although the Gnathostoma antigens are immunogenic, the level of antibody responses may be insufficient for protection or may be biased by antibody isotype switching. Therefore, the use of an appropriate immuno-modulating strategy is necessary to obtain protective immunity by vaccination.
Unmethylated CpG oligonucleotides (CpG ODNs) are known to modulate both innate and adaptive immune responses through initiating Toll-like receptor 9 [18,19]. Activation of dendritic cells by CpG ODN induces cell maturation and production of proinflammatory cytokines such as interleukin (IL)-1, IL-6, TNF-α, and type 1 interferon, as well as T-helper 1 (Th1)-promoting cytokine IL-12 [20,21]. Delivery of CpG ODN with various antigens can enhance antigen-specific cell-mediated and humoral immunity [22-24]. CpG ODNs have been used as an adjuvant for enhancing immunity against various parasitic infections, including malaria [25-29].
In this study, mice were immunized with crude antigens of G. spinigerum with the combined adjuvant of CpG ODN 1826 and Montanide ISA720. The antibody responses and protective effects against G. spinigerum challenge infection was investigated.
Mice and parasites
Male Swiss albino mice, weighing 25-30 g, were obtained from the National Laboratory Animal Centre, Salaya, Nakhon Pathom, Thailand, and kept in the Animal Unit of the Faculty of Medicine, Khon Kaen University. Five mice were randomly placed into each cage containing wood shavings. Rodent's chow and water were given ad libitum. All animal experiments were performed according the Guidelines for Animal Experimentation of the National Research Council of Thailand and the study was approved by the Animal Ethics Committee of Khon Kaen University (reference no. 0501.04/0013). G. spinigerum advanced third-stage larvae (AL3) were maintained in our laboratory according to procedures described previously [30] and used for antigen preparation and challenge infection.
Crude G. spinigerum antigen, oil-based adjuvant, and oligonucleotides (ODNs)
Crude somatic antigen of G. spinigerum AL3 was produced as described previously [17]. The ODNs used in this study were CpG 1826 (TCCATGACGTTCCTGACGTT; the underlined nucleotides represent the immunostimulatory residues) and the control non-CpG ODN 2138 (TCCATGAGCTTCCTGAGCTT) (Coley Pharmaceutical Group, Wellesley Hills, Massachusetts, USA). Montanide ISA720 (Seppic, Paris, France), an oil-based adjuvant, was also used.
Immunization and challenge infection
The experimental design is summarized in Table 1. Ten mice of each group were immunized with either crude G. spinigerum antigen (GsAg; 350 µg/mouse) or normal saline solution (NSS) (control). Crude antigen or NSS incorporated in Montanide ISA720 only, or in Montanide ISA720 with CpG ODN 1826 or non-CpG ODN 2138, was administered on days 0 and 21 post-immunization (PI) via subcutaneous injections and then on days 42 and 56 PI via intraperitoneal injections. Mice were challenged orally with 4 live G. spinigerum AL3 28 days after the last immunization (i.e. day 84 after the start of the experiment). All mice were sacrificed at day 196 after the start of the experiment. The worm burdens were determined by counting the Gnathostoma larvae in all organs under a light stereomicroscope (×15-45).
Antibody assay
Sera were collected 1 day before and then every 1-4 weeks after the first immunization, and G. spinigerum-specific antibody levels were assessed by ELISA. The dilutions of serum, horseradish peroxidase (HRP)-conjugated anti-mouse antibody, biotin-conjugated anti-mouse antibody, and avidin-HRP conjugate in each assay are shown in Table 2. A high binding capacity ELISA plate (Corning Incorporated, New York, USA) was coated with 100 µl of 2.5 µg/ml of GsAg in a coating buffer overnight at 4℃. After 3 washes with 0.05% Tween 20 in PBS (PBST), the wells were blocked with 250 µl of 3% bovine serum albumin (BSA; fraction V; Sigma, St. Louis, Missouri, USA) at room temperature for 1 hr. After washing, 100 µl of optimum dilutions of serum were added. After incubation at 37℃ for 1 hr, the wells were washed. For IgG and IgG2b determination, HRP-conjugated anti-mouse IgG and IgG2b antibodies (Zymed Laboratories, South San Francisco, California, USA) were added, respectively. After incubation at 37℃ for 1 hr, the wells were washed and o-phenylenediamine (OPD; Sigma) substrate solution was added and incubated at room temperature for 30 min before adding 8 N H2SO4 to stop the reaction. The optical density (OD) was read at the wave-length of 490 nm by an ELISA reader. For IgM, IgE, IgA, IgG1, IgG2a, and IgG3 determination, biotin-conjugated anti-mouse IgM, IgE, IgA, IgG1, IgG2a, and IgG3 antibodies and avidin-HRP conjugate (BD Pharmingen, California, USA) were used, respectively.
Parasite burdens and histological study
At the end of the experiment, all animals were sacrificed by ether inhalation. Worm burden and recovery were determined by counting the worms in all organs by the compression method under a stereomicroscope.
Statistical analysis
The significance of the difference between pairs of groups was analyzed by the Student's t-test or Mann-Whitney Rank Sum Test as appropriate. The results in the different groups were compared using the non-parametric Kruskal-Wallis One Way Analysis of Variance on Rank.
Antibody response after immunization with crude G. spinigerum antigen
To examine the kinetics of the antibody responses after immunization, sera were collected from mice of all groups and assessed for IgG, IgM, IgE, IgA, and IgG isotypes (IgG1, IgG2a, IgG2b, and IgG3) specific for GsAg. Control mice in groups 4-7 (Table 1) did not produce antibodies to GsAg. Mice immunized with GsAg mixed with Montanide ISA720 and CpG ODN 1826 (group 1), or with Montanide ISA720 and non-CPG ODN 2138 (group 2), or with Montanide ISA720 alone (group 3) produced high levels of all antibody classes and IgG subclasses, except IgA antibody, specific to G. spinigerum antigen (Fig. 1). The IgG antibody responses in mice in groups 1-3 were not significantly different as determined immediately before the challenge infection (at week 4 after the last immunization) (mean OD±SE; 1.95±0.12, 2.04±0.10, and 1.94±0.10, respectively, P>0.05; Fig. 1C), as were IgM and IgE antibody responses (mean OD±SE: IgM; 0.98±0.13, 1.29±0.20, and 1.08±0.12, respectively, P>0.05; Fig. 1A; and mean OD±SE: IgE; 0.30±0.03, 0.34±0.05, and 0.30±0.05, respectively, P>0.05; Fig. 1B).
The IgG1 antibody responses in mice immunized with GsAg mixed with Montanide ISA720 and CpG ODN (group 1) were statistically significantly lower than those in mice immunized with the GsAg in Montanide ISA720 and non-CpG ODN, or with GsAg in Montanide ISA720 at 4 weeks after the last immunization (mean OD±SE; 1.66±0.02 versus 1.82±0.03, or 1.77±0.04, respectively, P<0.05; Fig. 1D). By contrast, IgG2a, IgG2b, and IgG3 antibody responses of mice immunized with GsAg mixed with Montanide ISA720 and CpG ODN were significantly higher than those of mice immunized with GsAg in Montanide ISA720 and non-CpG ODN or with GsAg in Montanide ISA720 at week 12 after the first immunization (mean OD±SE of IgG2a; 1.12±0.05, 0.56±0.12, 0.48±0.09, respectively, P<0.05; Fig. 1E mean OD±SE of IgG2b; 2.07±0.17, 1.45±0.15, 1.60±0.14, respectively, P<0.05; Fig. 1F mean O.D.±SE of IgG3; 2.05±0.19, 1.04±0.27, 0.35±0.12, respectively, P<0.05 Fig. 1G). In addition, the ratio of IgG2a/IgG1 antibody levels of mice immunized with GsAg in Montanide ISA720 and CpG ODN was higher than those of the other groups (Fig. 2A).
Antibody responses of immunized mice after challenge infection with G. spinigerum
Following a G. spinigerum challenge, antibodies in all immunized mice were monitored (Fig. 3). Control mice immunized with adjuvant only produced some IgG and IgM, but little IgE, and no IgA antibodies. The IgG and IgM antibody levels in control mice reached a peak between week 3 and 6 after the challenge but the levels were far less than those of immunized mice. In contrast, the IgG antibody levels of immunized mice after challenge infection remained high for a few weeks then gradually decreased regardless of the types of adjuvant used. In contrast, the IgM levels of immunized mice increased during the first week after challenge infection then gradually decreased. In terms of IgG subclass responses, IgG1 antibody levels remained high, whereas those of IgG2a, IgG2b, and IgG3 decreased continuously. Actually the IgG3 antibody levels started to drop after the 4th week post challenge (Fig. 3G), except for the group immunized with GsAg in Montanide ISA720 and CpG ODN, which increased for 2 weeks before dropping. The IgG2a/IgG1 ratios decreased over time after challenge infection (Fig. 2B).
Parasite burdens
We investigated the protective effect of the immunization by determining the worm recovery at week 16 post challenge. No significant differences of worm recovery were observed among groups of immunized and non-immunized mice (mean worm recovery±SE of groups 1-7; 3. 6±0.7, 3.9±0.3, 3.8±0.7, 3.9±0.4, 3.1±0.8, 3.1±0.8, and 3.3±0.7, respectively; P>0.05).
In an attempt to overcome a round worm infection, we used an immunostimulatory oligodeoxynucleotide containing unmethylated CpG motif (CpG ODN 1826) to combine with oil-based Montanide ISA720, which has been proven to be safe in human immunization trials [31]. After challenging with Gnathostoma larvae, immunized mice were not protected as demonstrated by the worm recovery. Our study showed that mice immunized with G. spinigerum crude antigen produced all antibody classes and subclasses to G. spinigerum protein except IgA antibodies (Fig. 1). Neither the presence of CpG ODN 1826 nor non-CpG ODN in the immunization, increased the levels of the IgG1 antibody responses, relative to Montanide ISA alone (Fig. 1D), suggesting that CpG ODN did not enhance an IgG1 response. By contrast, IgG2a, IgG2b, and IgG3 antibody levels were consistently higher after immunization with CpG ODN, compared to the other adjuvant regimes (Fig. 1E-G), suggesting a role of CpG ODN in the induction of a Th1-type biased response.
After challenge infection with live G. spinigerum AL3, antibody responses were observed in all groups of mice. In the control groups treated with adjuvants only, IgM and IgG1 were detected 1 week after infection and sustained at high levels for up to 16 weeks of study (Fig. 3A, D). In contrast, the IgG2a, Ig2b, and IgG3 antibody responses to the infection were negligible (Fig. 3E-G). These findings may suggest that infection with live G. spinigerum larvae results in a strong Th2-type biased response [32]. This suggestion was also supported by the data of the groups of mice immunized with G. spinigerum crude antigen prior to infection. These groups showed sustained levels of IgG1 but continuously decreasing levels of IgG2a, IgG2b, and IgG3 (Fig. 3D-G), and opposite IgG2a/IgG1 ratios before and after infection (Fig. 2). In addition, it is possible that the failure of mice to develop protective immunity and the survival of parasite larvae after challenge infection observed in this experiment may be due to the escape mechanisms of this parasite by a biased regulation of the type of antibody responses, through which h2-producing cells [33]. This needs to be further studied.
We conclude that the crude Gnathostoma larval antigen with CpG ODN can induce high immune responses with a shift to a Th1-type response after immunization but no protection is achieved together with the shift to Th2-response after infection. The development of vaccine for this disease may require more understanding of the mechanisms of immune regulation by the parasite.
National Science and Technology Development AgencyThailand Research FundRTA5580004
This research was funded by grants from the National Science and Technology Development Agency (Discovery Based Development Grant); the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission, Thailand through Health Cluster (SHeP GMS); the Faculty of Medicine, Khon Kaen University. Wanchai Maleewong and Pewpan M. Intapan were supported by TRF Senior Research Scholar Grant, Thailand Research Fund grant no. RTA5580004. We wish to acknowledge the support of the Khon Kaen University Publication Clinic, Research and Technology Transfer Affairs, Khon Kaen University, for their assistance. We wish to thank Dr. Yukifumi Nawa for valuable comments and suggestions and Dr. Arthur M. Krieg for his providing the CpG ODN 1826 and the control non-CpG ODN 2138.
  • 1. Miyazaki I. On the genus Gnathostoma and human gnathostomiasis, with special reference to Japan. Exp Parasitol 1960;9:338-370.
  • 2. Nawa Y. Historical review and current status of gnathostomiasis in Asia. Southeast Asian J Trop Med Public Health 1991;22:217-219.
  • 3. Moore DA, McCroddan J, Dekumyoy P, Chiodini PL. Gnathostomiasis: an emerging imported disease. Emerg Infect Dis 2003;9:647-650.
  • 4. Herman JS, Chiodini PL. Gnathostomiasis, another emerging imported disease. Clin Microbiol Rev 2009;22:484-492.
  • 5. Daengsvang S. Gnathostomiasis in Southeast Asia. Southeast Asian J Trop Med Public Health 1981;12:319-332.
  • 6. Boongird P, Phuapradit P, Siridej N, Chirachariyavej T, Chuahirun S, Vejjajiva A. Neurological manifestations of gnathostomiasis. J Neurol Sci 1977;31:279-291.
  • 7. Jaroonvesama N. Differential diagnosis of eosinophilic meningitis. Parasitol Today 1988;4:262-266.
  • 8. Schmutzhard E, Boongird P, Vejjajiva A. Eosinophilic meningitis and radiculomyelitis in Thailand, caused by CNS invasion of Gnathostoma spinigerum and Angiostrongylus cantonensis. J Neurol Neurosurg Psychiatry 1988;51:80-87.
  • 9. Graeff-Teixeira C, da Silva AC, Yoshimura K. Update on eosinophilic meningoencephalitis and its clinical relevance. Clin Microbiol Rev 2009;22:322-348.
  • 10. Kraivichian K, Nuchprayoon S, Sitichalernchai P, Chaicumpa W, Yentakam S. Treatment of cutaneous gnathostomiasis with ivermectin. Am J Trop Med Hyg 2004;71:623-628.
  • 11. Strady C, Dekumyoy P, Clement-Rigolet M, Danis M, Bricaire F, Caumes E. Long-term follow-up of imported gnathostomiasis shows frequent treatment failure. Am J Trop Med Hyg 2009;80:33-35.
  • 12. Anantaphruti M, Waikagul J, Nithi-Uthai S, Pubampen S, Rojekittikhun W. Detection of humoral immune response to Gnathostoma spinigerum in mice. Southeast Asian J Trop Med Public Health 1986;17:172-176.
  • 13. Anantaphruti MT, Nuamtanong S, Dekumyoy P. Diagnostic values of IgG4 in human gnathostomiasis. Trop Med Int Health 2005;10:1013-1021.
  • 14. Maleewong W, Morakote N, Thamasonthi W, Charuchinda K, Tesana S, Khamboonruang C. Serodiagnosis of human gnathostomiasis. Southeast Asian J Trop Med Public Health 1988;19:201-205.
  • 15. Tapchaisri P, Nopparatana C, Chaicumpa W, Setasuban P. Specific antigen of Gnathostoma spinigerum for immunodiagnosis of human gnathostomiasis. Int J Parasitol 1991;21:315-319.
  • 16. Nuchprayoon S, Sanprasert V, Suntravat M, Kraivichian K, Saksirisampant W, Nuchprayoon I. Study of specific IgG subclass antibodies for diagnosis of Gnathostoma spinigerum. Parasitol Res 2003;91:137-143.
  • 17. Laummaunwai P, Sawanyawisuth K, Intapan PM, Chotmongkol V, Wongkham C, Maleewong W. Evaluation of human IgG class and subclass antibodies to a 24 kDa antigenic component of Gnathostoma spinigerum for the serodiagnosis of gnathostomiasis. Parasitol Res 2007;101:703-708.
  • 18. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S. A Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740-745.
  • 19. Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709-760.
  • 20. Sparwasser T, Koch ES, Vabulas RM, Heeg K, Lipford GB, Ellwart JW, Wagner H. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol 1998;28:2045-2054.
  • 21. Behboudi S, Chao D, Klenerman P, Austyn J. The effects of DNA containing CpG motif on dendritic cells. Immunology 2000;99:361-366.
  • 22. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546-549.
  • 23. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp Med 1997;186:1623-1631.
  • 24. Roman M, Martin-Orozco E, Goodman JS, Nguyen MD, Sato Y, Ronaghy A, Kornbluth RS, Richman DD, Carson DA, Raz E. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat Med 1997;3:849-854.
  • 25. Zimmermann S, Egeter O, Hausmann S, Lipford GB, Röcken M, Wagner H, Heeg K. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J Immunol 1998;160:3627-3630.
  • 26. Zimmermann S, Dalpke A, Heeg K. CpG oligonucleotides as adjuvant in therapeutic vaccines against parasitic infections. Int J Med Microbiol 2008;298:39-44.
  • 27. Kringel H, Dubey JP, Beshah E, Hecker R, Urban JF Jr. CpG-oligodeoxynucleotides enhance porcine immunity to Toxoplasma gondii. Vet Parasitol 2004;123:55-66.
  • 28. Guo YJ, Wu D, Wang KY, Sun SH. Adjuvant effects of bacillus Calmette-Guerin DNA or CpG-oligonucleotide in the immune response to Taenia solium cysticercosis vaccine in porcine. Scand J Immunol 2007;66:619-627.
  • 29. Hirunpetcharat C, Wipasa J, Sakkhachornphop S, Nitkumhan T, Zheng YZ, Pichyangkul S, Krieg AM, Walsh DS, Heppner DG, Good MF. CpG oligodeoxynucleotide enhances immunity against blood-stage malaria infection in mice parenterally immunized with a yeast-expressed 19 kDa carboxyl-terminal fragment of Plasmodium yoelii merozoite surface protein-1 (MSP119) formulated in oil-based Montanides. Vaccine 2003;21:2923-2932.
  • 30. Maleewong W, Loahabhan P, Wongkham C, Intapan P, Morakote N, Khamboonruang C. Effects of albendazole on Gnathostoma spinigerum in mice. J Parasitol 1992;78:125-126.
  • 31. Lawrence GW, Saul A, Giddy AJ, Kemp R, Pye D. Phase I trial in humans of an oil-based adjuvant SEPPIC MONTANIDE ISA 720. Vaccine 1997;15:176-178.
  • 32. Voehringer D. The role of basophils in helminth infection. Trends Parasitol 2009;25:551-556.
  • 33. Hewitson JP, Grainger JR, Maizels RM. Helminth immunoregulation: the role of parasite secreted proteins in modulating host immunity. Mol Biochem Parasitol 2009;167:1-11.
Fig. 1
Kinetics of G. spinigerum-specific antibody class and subclass levels during the course of immunization. Mice were immunized at weeks 0, 3, 6, and 8 with G. spinigerum crude antigen in NSS mixed with Montanide ISA720, with or without CpG ODN 1826 or non-CpG ODN 2138. Sera were collected 1 day before each immunization and every 2 weeks after the last immunization, diluted to the optimal level (see Table 2), and assessed for G. spinigerum-specific IgM, IgE, IgA, IgG, and their subclasses by ELISA. Data show mean±E of OD. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
kjp-51-637-g001.jpg
Fig. 2
The ratios of IgG2a/IgG1 antibody levels of mice during the course of immunization and post challenge infection. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
kjp-51-637-g002.jpg
Fig. 3
Kinetics of G. spinigerum-specific antibody class and subclass levels post challenge infection with live G. spinigerum AL3. Four weeks after the last immunization, each mouse was challenged orally with 4 live G. spinigerum AL3. Sera were collected every 1, 2, or 4 weeks after challenge infection, diluted to optimum levels (see Table 2), and assessed for G. spinigerum-specific IgM, IgE, IgA, IgG, and their subclasses by ELISA. Data show mean±SE of OD. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
kjp-51-637-g003.jpg
Table 1.
The experimental design for immunization
Table 1.
Group Immunization typesa
1 Gnathostoma spinigerum antigen in NSS+Montanide ISA720+CpG ODN 1826
2 Gnathostoma spinigerum antigen in NSS+Montanide ISA720+non-CpG ODN 2138
3 Gnathostoma spinigerum antigen in NSS+Montanide ISA720
4 NSS+Montanide ISA720+CpG ODN 1826
5 NSS+Montanide ISA720+non-CpG ODN 2138
6 NSS+Montanide ISA720
7 NSS

NSS, normal saline solution (0.85% NaCl in distilled water).

aMontanide ISA720 in groups 1-6 was emulsified with other solutions at a ratio of 7:3.

Table 2.
Optimum dilutions of sera and conjugates used for determination of Gnathostoma spinigerum-specific antibody classes and subclasses by ELISA
Table 2.
Antibody detected Dilution used
Serum Biotinylated antibody Avidin-peroxidase conjugate HRP-conjugated antibody
IgG1 1:400 1:50,000 1:50,000
IgG2a 1:400 1:50,000 1:50,000
IgG2b 1:400 1:100,000
IgG3 1:200 1:5,000 1:5,000
IgG 1:50 1:1,000
IgM 1:200 1:5,000 1:5,000
IgE 1:200 1:2,000 1:1,000
IgA 1:200 1:5,000 1:5,000

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Modulation of Antibody Responses against Gnathostoma spinigerum in Mice Immunized with Crude Antigen Formulated in CpG Oligonucleotide and Montanide ISA720
Korean J Parasitol. 2013;51(6):637-644.   Published online December 31, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Modulation of Antibody Responses against Gnathostoma spinigerum in Mice Immunized with Crude Antigen Formulated in CpG Oligonucleotide and Montanide ISA720
Korean J Parasitol. 2013;51(6):637-644.   Published online December 31, 2013
Close

Figure

  • 0
  • 1
  • 2
Modulation of Antibody Responses against Gnathostoma spinigerum in Mice Immunized with Crude Antigen Formulated in CpG Oligonucleotide and Montanide ISA720
Image Image Image
Fig. 1 Kinetics of G. spinigerum-specific antibody class and subclass levels during the course of immunization. Mice were immunized at weeks 0, 3, 6, and 8 with G. spinigerum crude antigen in NSS mixed with Montanide ISA720, with or without CpG ODN 1826 or non-CpG ODN 2138. Sera were collected 1 day before each immunization and every 2 weeks after the last immunization, diluted to the optimal level (see Table 2), and assessed for G. spinigerum-specific IgM, IgE, IgA, IgG, and their subclasses by ELISA. Data show mean±E of OD. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
Fig. 2 The ratios of IgG2a/IgG1 antibody levels of mice during the course of immunization and post challenge infection. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
Fig. 3 Kinetics of G. spinigerum-specific antibody class and subclass levels post challenge infection with live G. spinigerum AL3. Four weeks after the last immunization, each mouse was challenged orally with 4 live G. spinigerum AL3. Sera were collected every 1, 2, or 4 weeks after challenge infection, diluted to optimum levels (see Table 2), and assessed for G. spinigerum-specific IgM, IgE, IgA, IgG, and their subclasses by ELISA. Data show mean±SE of OD. Group (Grp.) 1=GsAg+ISA+CpG ODN; Group 2=GsAg+ISA+ODN; Group 3=GsAg+ISA; Group 4=NSS+ISA+CpG ODN; Group 5=NSS+ISA+ODN; Group 6=NSS+ISA; Group 7=NSS.
Modulation of Antibody Responses against Gnathostoma spinigerum in Mice Immunized with Crude Antigen Formulated in CpG Oligonucleotide and Montanide ISA720
Group Immunization typesa 1 Gnathostoma spinigerum antigen in NSS+Montanide ISA720+CpG ODN 1826 2 Gnathostoma spinigerum antigen in NSS+Montanide ISA720+non-CpG ODN 2138 3 Gnathostoma spinigerum antigen in NSS+Montanide ISA720 4 NSS+Montanide ISA720+CpG ODN 1826 5 NSS+Montanide ISA720+non-CpG ODN 2138 6 NSS+Montanide ISA720 7 NSS Antibody detected Dilution used
Serum Biotinylated antibody Avidin-peroxidase conjugate HRP-conjugated antibody IgG1 1:400 1:50,000 1:50,000 IgG2a 1:400 1:50,000 1:50,000 IgG2b 1:400 1:100,000 IgG3 1:200 1:5,000 1:5,000 IgG 1:50 1:1,000 IgM 1:200 1:5,000 1:5,000 IgE 1:200 1:2,000 1:1,000 IgA 1:200 1:5,000 1:5,000
Table 1. The experimental design for immunization

NSS, normal saline solution (0.85% NaCl in distilled water).

Montanide ISA720 in groups 1-6 was emulsified with other solutions at a ratio of 7:3.

Table 2. Optimum dilutions of sera and conjugates used for determination of Gnathostoma spinigerum-specific antibody classes and subclasses by ELISA