Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Molecular Identification of Haemadipsa rjukjuana (Hirudiniformes: Haemadipsidae) in Gageo Island, Korea

The Korean Journal of Parasitology 2014;52(2):169-175.
Published online: April 18, 2014

1Laboratory of Veterinary Internal Medicine, Research Institute for Veterinary Science and College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea.

2College of Veterinary Medicine, Chungnam National University, Daejeon 306-764, Korea.

3National Institute of Biological Resources, Incheon 404-708, Korea.

Corresponding author (jschae@snu.ac.kr)

Current address: Department of Climate and Ecology, National Institute of Ecology, Seocheon 325-813, Korea.

• Received: August 31, 2013   • Revised: January 13, 2014   • Accepted: January 24, 2014

© 2014, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 13,339 Views
  • 148 Download
  • 12 Web of Science
  • 12 Crossref
  • 13 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Unraveling the structure, chemical composition, and conserved signaling in leech teeth
    Yam Prasad Aryal, Sanjiv Neupane, Hee-Jin Kwak, Chang-Hyeon An, Wern-Joo Sohn, Hitoshi Yamamoto, Tae-Yub Kwon, Bong-Ki Min, Jae-Young Kim, Sung-Jin Cho
    Animal Cells and Systems.2024; 28(1): 272.     CrossRef
  • Differential Analysis in DNA Molecular and Protein Composition of Hirudo Nipponia Whitman Using DNA Barcoding and Protein-Based Reversed-Phase Hplc Fingerprint Analysis
    Qian Gao, Jianyuan Tang, Li Zhiyong, Hang Xiao, Zhaoshun Luo, Mengmeng Shi, Linchun Shi, Feng Qiu, Li Ma
    SSRN Electronic Journal.2023;[Epub]     CrossRef
  • First Record of a Cavernous Land Leech Sinospelaeobdella cavatuses (Hirudinda: Haemadipsidae) from Thailand
    Teerapong Seesamut, Ratmanee Chanabun, Natdanai Likhitrakarn, Warut Siriwut, Ruttapon Srisonchai, Arthit Pholyotha, Chirasak Sutcharit, Ekgachai Jeratthitikul
    Tropical Natural History.2023; (7): 213.     CrossRef
  • Characterization of the complete mitochondrial genome of Haemadipsa tianmushana Song 1977 (Hirudiniformes, Haemadipsidae) and its phylogenetic analysis
    Fuhua Lu, Mengmeng Shi, Jiali Liu, Weijun Kong, Yufeng Zhang, Linchun Shi
    Mitochondrial DNA Part B.2022; 7(1): 103.     CrossRef
  • An annotated checklist of the eukaryotic parasites of humans, exclusive of fungi and algae
    Blaine A. Mathison, Sarah G. H. Sapp
    ZooKeys.2021; 1069: 1.     CrossRef
  • Nuclear microsatellite and mitochondrial DNA analyses reveal the regional genetic structure and phylogeographical history of a sanguivorous land leech, Haemadipsa japonica, in Japan
    Kaori Morishima, Mineaki Aizawa
    Ecology and Evolution.2019; 9(9): 5392.     CrossRef
  • Analysis of genetic variation in mitochondrial cytochrome c oxidase subunit 1 between Haemadipsa japonica in Japan and land leeches worldwide
    Naoe Sato, Chikako Yokoyama, Miki Inukai, Saeko Miyashita, Keito Nagase, Takafumi Nakano, Katsuya Iuchi, Hisashi Hisatomi
    Mitochondrial DNA Part B.2019; 4(1): 1408.     CrossRef
  • Ehrlichia species in pond-farmed leeches (Hirudinaria sp.) in Hubei Province, China
    Shu-Han Zhou, Xiao Xiao, Yi-Na Sun, Xiao-Hui Xu, Xin Ding, Si-Yi Zhang, Min Zhang, Wen-Liang Lv, Qing-Hua Gao, J. Stephen Dumler
    PLOS ONE.2019; 14(4): e0215082.     CrossRef
  • Characterization of 13 polymorphic microsatellite loci in the Japanese land leech
    Kaori Morishima, Tomohiro Suzuki, Mineaki Aizawa
    Parasitology International.2018; 67(1): 13.     CrossRef
  • Bloodlines: mammals, leeches, and conservation in southern Asia
    Michael Tessler, Sarah R. Weiskopf, Lily Berniker, Rebecca Hersch, Kyle P. Mccarthy, Douglas W. Yu, Mark E. Siddall
    Systematics and Biodiversity.2018; 16(5): 488.     CrossRef
  • Development of a Novel Wound Dressing Coated with Drug-loaded Mesenchymal StemCells to Promote Wound Healing in Diabetics
    Albandari Bin-ammar, Mark Slevin, Nessar Ahmed, Donghui Liu
    ETP International Journal of Food Engineering.2018; : 245.     CrossRef
  • Molecular detection of Bartonella spp. in terrestrial leeches (Haemadipsa rjukjuana) feeding on human and animal blood in Gageo-do, Republic of Korea
    Jun-Gu Kang, Sohyun Won, Hye-Won Kim, Baek-Jun Kim, Bae-Keun Park, Tae-Seo Park, Hong-Yul Seo, Joon-Seok Chae
    Parasites & Vectors.2016;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Molecular Identification of Haemadipsa rjukjuana (Hirudiniformes: Haemadipsidae) in Gageo Island, Korea
Korean J Parasitol. 2014;52(2):169-175.   Published online April 18, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Molecular Identification of Haemadipsa rjukjuana (Hirudiniformes: Haemadipsidae) in Gageo Island, Korea
Korean J Parasitol. 2014;52(2):169-175.   Published online April 18, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Molecular Identification of Haemadipsa rjukjuana (Hirudiniformes: Haemadipsidae) in Gageo Island, Korea
Image Image Image Image Image
Fig. 1 Dock-Sil Mountain (▴, altitude 639 m) in Gageo-do (Island) (125°7"E, 34°4"N), Korea. Gageo-do is at Shinan-gun, Jeollanam-do (Province) and Korea's south-westernmost Island. Dock-Sil Mountain is the highest peak in Shinan-gun. (A) The geographical map of Asia. (B) The location of Mokpo (•), Heuksan-do (⋆), and Gageo-do, Korea. Gageo-do is 136 km distant from Mokpo and 70 km from Heuksan-do. (C) A map showing the topography of the Gageo-do and Dock-sil Mountain (▴).
Fig. 2 Terrestrial leeches collected from Gageo-do, Korea. (A) 10 min after feeding blood on a human leg. (B) 30 min after feeding on a human leg. (C, D) 70% alcohol-fixed terrestrial leeches after feeding.
Fig. 3 Results of PCR amplification of COI and 18S rRNA genes from the Gageo-do land leech. (A) COI gene PCR amplicons (710 bp). (B) 18S rRNA gene amplicons (1.2 kb). Out of the total 1.8 kb 18S rRNA, PCR amplifications were conducted in 2 independent parts which are overlapped each other with approximately 1.2 kb in length; M, Elpis 100 bp marker; 1, 2, 3, and 4; Gageo land leeches sample.
Fig. 4 A phylogenetic tree illustrating the genetic relationship of Haemadipsoid leeches using the neighbor-joining method implemented in Clustal X algorithm with Mega 4.0. 18S rRNA gene sequences of Haemadipsa rjukjuana obtained from Mt. Dock-Sil in Gageo-do, Shinan-gun, Jeollanam-do, Korea compared to previous reference sequences. Bold letters are sequences identified in this study.
Fig. 5 Phylogenetic tree for COI gene showing the taxonomic status of haemadipsoid leeches using the neighbor-joining method implemented. COI gene sequences of Haemadipsa rjukjuana obtained from Mt. Dock-Sil in Gageo-do, Shinan-gun, Jeollanam-do, Korea. Bold letters are sequences identified in this study. H. rjukjuana Gageo 1 indicates COI type A and H. rjukjuana Gageo 27 indicates COI type B.
Molecular Identification of Haemadipsa rjukjuana (Hirudiniformes: Haemadipsidae) in Gageo Island, Korea
Target genes Name of PCR primers primer sequences (5´-3´) PCR product size References Nuclear 18S rRNAa A AACCTGGTTGATCCTGCCAGT 1.2 kb Apakupakul et al. [15] Y CAGACAAATCGCTCC C CGGTAATTCCAGCTC 1.2 kb B TGATCCTTCCGCAGGTTCACCT Mitochondrial CO1 LCO 1490 GGTCAACAAATCATAAAGATATTGG 710 bp Folmer et al. [16] HCO 2198 TAAACTTCAGGGTGACCAAAAAATCA Taxon Locality GenBank accession no.
18S rNRA COI Haemadipsa rjukjuana Gageo (In this study) Gageo Islands, Korea KC524508a - Haemadipsa rjukuana Gageo 1 (In this study) Gageo Islands, Korea - KC524509a Haemadipsa rjukjuana Gageo 27 (In this study) Gageo Islands, Korea - KC524510a Haemadipsa rjukjuana L00112A Taiwan - HQ322438 Haemadipsa rjukjuana L00115A Taiwan - HQ322443 Haemadipsa rjukjuana L00098A Ryukyu Islands, Japan - HQ322462 Haemadipsa hainana voucher L00153A Hainan Island, China - HQ322473 Haemadipsa picta voucher L00151A Taiwan - HQ322470 Haemadipsa rjukjuana isolate HARY Taiwan HQ203097 HQ203174 Haemadipsa limuna isolate HACH China HQ207191 HQ203169 Haemadipsa montana isolate HZKI Nepal HQ203105 HQ203182 Haemadipsa ornata isolate HPISUM Sumatra HQ203101 HQ203178 Haemadipsa trimaculosa isolate HAKY Thailand HQ203095 HQ203172 Haemadipsa interrupta Thailand EU100069 EU100091 Haemadipsa sumatrana Borneo AY425464 AY425446 Haemadipsa sylvestris Vietnam AF116005 AF003266 Chtonobdella bilineata Australia AF116006 AF003267 Chtonobdella whitmani Australia EU100065 EU100087 Idiobdella seychellensis Seychelle Islands EU100070 EU100094 Malagabdella fallax Madagascar EU100071 EU100096 Diestecostoma mexicana Mexico EU100068 EU100089 Xerobdella lecometi Slovenia AF099947 EU100099 Aliolimnatis michaelseni Congo AF116010 AF116029 Hirudo medicinalis France AY786464 EU100093
Table 1. Nucleotide sequences of PCR primers and conditions for amplification of 18S rRNA and COI genes
Table 2. Collection localities and GenBank accession numbers used for phylogenetic analyses of haemadipsoid leeches in this study

GenBank accession numbers of H. rjukjuana Gageo which were acquired in this study are contemporary numbers, and the record is processing to release to the public database.