Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Identification of a Novel Microtubule-Binding Protein in Giardia lamblia

The Korean Journal of Parasitology 2016;54(4):461-469.
Published online: August 31, 2016

Department of Environmental Medical Biology and Institute of Tropical Medicine, Brain Korea 21 PLUS Project for Medical Science, Yonsei University College of Medicine, Seoul 03722, Korea

*Corresponding author (sjpark615@yuhs.ac)
• Received: December 3, 2015   • Revised: April 28, 2016   • Accepted: May 26, 2016

© 2016, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,123 Views
  • 163 Download
  • 3 Web of Science
  • 2 Crossref
  • 2 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Giardia intraflagellar transport protein 88 is involved in flagella formation
    Hye Rim Yeo, Mee Young Shin, Juri Kim, Soon-Jung Park
    Parasites, Hosts and Diseases.2025; 63(1): 12.     CrossRef
  • Giardia intestinalis coiled-coil cytolinker protein 259 interacts with actin and tubulin
    Omar Rojas-Gutiérrez, Armando Pérez-Rangel, Araceli Castillo-Romero, José Tapia-Ramírez, Emmanuel Ríos-Castro, Minerva Camacho-Nuez, Silvia Giono-Cerezo, Benjamín Nogueda-Torres, Gloria León-Avila, José Manuel Hernández
    Parasitology Research.2021; 120(3): 1067.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of a Novel Microtubule-Binding Protein in Giardia lamblia
Korean J Parasitol. 2016;54(4):461-469.   Published online August 31, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of a Novel Microtubule-Binding Protein in Giardia lamblia
Korean J Parasitol. 2016;54(4):461-469.   Published online August 31, 2016
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Identification of a Novel Microtubule-Binding Protein in Giardia lamblia
Image Image Image Image Image
Fig. 1. Identification of GlMBP1, an MT-binding protein from Giardia extracts via in vitro MT-binding assays. (A) Trophozoites of G. lamblia WB were resuspended in PBS, and lysed by sonication. The binding of Giardia lysates to polymerized MTs was assessed in vitro using a Microtubule-Binding Protein Spin-Down Assay Kit BK029 (Cytoskeleton). Twenty µmoles of MTs was incubated with 100 µg of Giardia lysates in a total volume of 50 µl at room temperature for 40 min. The reaction mixtures were then centrifuged through a 50% glycerol cushion-PEM-taxol mixture at 100,000 g at 25˚C for 40 min using an ultracentrifuge. The pellet fraction was then resolved on 8% SDS-PAGE and visualized by silver staining. A sample with the same amount of Giardia extracts was precipitated by ultracentrifugation and compared side-by-side with the extracts precipitated with MTs. (B) An extended view of the SDS-PAGE gel showing proteins between 55 kDa and 25 kDa. (C) The protein band present only in the MT fraction was excised and digested with trypsin. The trypsin-treated proteins were analyzed by quadrupole time-of-flight (Q-TOF), in addition to matrix-assisted laser desorption ionization-TOF mass spectrometry (MALDI-TOF MS). For the Q-TOF liquid chromatography-tandem MS (LC-MS/MS) data sets, tandem mass spectra were submitted to our MASCOT in-house database search engine (NCBI NR database downloaded on 31 July 2009). For protein identification, a MASCOT ion score of >37 was used as the criterion for a meaningful result.
Fig. 2. In vitro MT-binding assays using rGlMBP1. Ten µg of rGlMBP1 was incubated without or with taxol-stabilized bovine MTs (20 µM), divided into pellet (P) and soluble (S) fractions by ultracentrifugation, and then separated by 12% SDS-PAGE. (A) A SDS-PAGE gel stained with Coomassie brilliant blue. (B) Western blot using anti-histidine antibodies (1:5,000 dilution). An arrowhead (about 55 kDa) indicates MTs, whereas arrows denote rGlMTBP.
Fig. 3. In vivo expression of GlMBP1 in G. lamblia trophozoites. (A) Quantitative measurement of GlMBP1 transcripts. Total RNA was isolated from G. lamblia using TRIzol. cDNA was synthesized from 5 µg of RNA using the ImProm-IITM RT system and then analyzed with the Light Cycler 480 II Real-Time PCR System using LightCycler 490 DNA SYBR Green I Master (Roche Applied Science). Conditions for real-time PCR were as follows: pre-incubation at 95˚C for 5 min followed by 45 amplification cycles of 95˚C for 10 sec, 56˚C for 20 sec, and 72˚C for 10 sec. Real-time PCR was carried out in triplicate in a 96-well plate using the specific primers listed in Table 1. The tim gene encoding triose-1-phosphate isomerase of G. lamblia was used as an endogenous control for the reactions. (B) Western blot analysis. Ten µg of Giardia extracts was separated by 12% SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was incubated with anti-GlMBP1 antibodies (1:1,000 dilution), followed by secondary antibodies (1:1,000 dilution).
Fig. 4. Expression of HA-tagged GlMBP1 in G. lamblia. (A) A schematic diagram of the plasmid pGlMBP1HA.pac. This plasmid contains the in-frame N-terminal end of the glmbp1 gene with 3 HA epitopes and the puromycin N-acetyltransferase gene (pac) cassette as a selective marker expressed from the glutamate dehydrogenase gene (gdh) promoter, Pgdh. (B) A strategy to integrate pGlMBP1HA.pac into a Giardia chromosome. Closed boxes show the plasmid sequences, and open boxes indicate Giardia chromosomal sequences. HA-tagging sequences and the pac cassette are indicated by gray boxes. (C) Genomic PCR analysis. PCR was performed using the GlMBP-F and GlMBP-HA-R or pac down primers on genomic DNA from G. lamblia WB cells or pGlMBP1HA.pac-transfected cells. (D) Western blot analysis. Ten µg of Giardia extracts (G. lamblia WB cells or pGlMBP1HA.pac-transfected cells) was separated by 12% SDS-PAGE and transferred to nitrocellulose membranes. The membrane was incubated with anti-HA antibodies (1:1,000 dilution), and then secondary antibodies (1:1,000 dilution).
Fig. 5. Localization of GlMBP1 in G. lamblia trophozoites. G. lamblia cells expressing HA-tagged GlMBP1 were fixed with chilled 100% methanol, and then permeabilized with PBS/0.5% Triton X-100. The cells were reacted with mouse anti-HA antibodies (1:50 dilution) and then incubated with AlexaFluor 488-conugated anti-mouse IgG (1:200). The cells were mounted on slides with VECTASHIELD Antifade Mounting Medium with 4ʹ,6-diamidino-2-phenylindole, and then observed with an Axiovert 200 fluorescence microscope (Carl Ziess). Differential interference contrast (DIC) images showed cell morphology. (A) IFA on G. lamblia WB using anti-HA antibodies. The bars indicate 2 µm. (B, C) IFA on G. lamblia with integrated HA-tagged glmbp1 using anti-HA antibodies. The bars indicate 2 µm. Arrowheads indicate median bodies, while arrows show basal bodies.
Identification of a Novel Microtubule-Binding Protein in Giardia lamblia
Strains/primers/plasmids Relevant characteristicsa Source or reference
G. lamblia
ATCC 30957 Clinical isolate ATCC
E. coli
DH5a supE44 DlacU169 (F80 lacZ DM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Invitrogen
BL21 (DE3) F’, ompT, hsdSB(rB-mB-) gal, dcm (DE3) Invitrogen
Primers
8405F GCGAATTCGATGTCGATGGACGTTCCTA (EcoRI)
8405R AGTTTAGCGGCCGCGCGCTTTGAGCCACACTCCA (NotI)
GlMBP-F CGATCCATGGCCGGCTCTTGTCCAACTGCT (NcoI)
GlMBP-HA-R GTTACGCGGCCGCTTAAGCGTAATCTGGAACATCG
TATGGGTAAGCGTAATCTGGAACATCGTATGGGTAA
GCGTAATCTGGAACATCGTATGGGTAGCGCTTTGAGCCACACTCCA (NcoI)
pac down CGCGAATTCTCAGGCACCGGGCTT
RT-tim_F CGAAAGTGGTTTGCGGAGAAG
RT-tim_R CTATGTACGGGTCTTCGTAAGA
RT-GlMBP-F GATGAAGTAGATAAGGCGGCA
RT-GlMBP-R GAGCCACACTCCATACAGAAT
Plasmids
pET21b Expression vector for a histidine-tagged protein Novagen
pETGlMBP1 pET21b, 1,338 bp encoding GlBMP1 (GiardiaDB; GL50803_8405) This study
pGFP.pac Shuttle vector, AmpR, pac gene Singer et al. [13]
pGlMBP1HA.pac pGFP.pac, 1,538 bp encoding GlMBP1 from its own promoter This study
Table 1. Strains, primers, and plasmids used in this study

Underlined bases indicate a restriction enzyme site.