Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Diversity of vir Genes in Plasmodium vivax from Endemic Regions in the Republic of Korea: an Initial Evaluation

The Korean Journal of Parasitology 2017;55(2):149-158.
Published online: April 30, 2017

1Department of Parasitology and Tropical Medicine, Kyungpook National University School of Medicine, Daegu 41944, Korea

2Laboratory of Parasitology, College of Veterinary Medicine, Kyungpook National University, Daegu 41566, Korea

3Pathogen Resource TF, Center for Infectious Diseases, Korea National Institute of Health, Korea CDC, Chungbuk 28159, Korea

4Division of Malaria and Parasitic Diseases, National Institute of Health, Korea CDC, Chungbuk 28159, Korea

5Laboratory of Veterinary Physiology & Cell Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 41566, Korea

*Corresponding author (dmkwak@knu.ac.kr; kuku1819@knu.ac.kr)
• Received: June 19, 2016   • Revised: February 15, 2017   • Accepted: February 19, 2017

Copyright © 2017 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 13,262 Views
  • 157 Download
  • 9 Web of Science
  • 9 Crossref
  • 8 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Genetic diversity and natural selection analysis of VAR2CSA and vir genes: implication for vaccine development
    Joseph Hawadak, Aditi Arya, Shewta Chaudhry, Vineeta Singh
    Genomics & Informatics.2024;[Epub]     CrossRef
  • Population genetic analysis of Plasmodium vivax vir genes in Pakistan
    Sylvatrie-Danne Dinzouna-Boutamba, Zin Moon, Sanghyun Lee, Sahib Gul Afridi, Hương Giang Lê, Yeonchul Hong, Byoung-Kuk Na, Youn-Kyoung Goo
    Parasites, Hosts and Diseases.2024; 62(3): 313.     CrossRef
  • Immunological characterization of a VIR protein family member (VIR-14) in Plasmodium vivax-infected subjects from different epidemiological regions in Africa and South America
    Raianna F. Fantin, Camila H. Coelho, Anne D. Berhe, Luisa M. D. Magalhães, Dhélio B. Pereira, Nichole D. Salinas, Niraj H. Tolia, Chanaki Amaratunga, Seila Suon, Issaka Sagara, David L. Narum, Ricardo T. Fujiwara, Claudia Abejon, Antonio Campos-Neto, Patr
    PLOS Neglected Tropical Diseases.2023; 17(4): e0011229.     CrossRef
  • Vivax Malaria and the Potential Role of the Subtelomeric Multigene vir Superfamily
    Youn-Kyoung Goo
    Microorganisms.2022; 10(6): 1083.     CrossRef
  • Genetic polymorphism of vir genes of Plasmodium vivax in Myanmar
    Byoung-Kuk Na, Tong-Soo Kim, Khin Lin, Moon-Chang Baek, Dong-Il Chung, Yeonchul Hong, Youn-Kyoung Goo
    Parasitology International.2021; 80: 102233.     CrossRef
  • Humoral and cellular immune response to Plasmodium vivax VIR recombinant and synthetic antigens in individuals naturally exposed to P. vivax in the Republic of Korea
    Sanghyun Lee, Young-Ki Choi, Youn-Kyoung Goo
    Malaria Journal.2021;[Epub]     CrossRef
  • Succinate dehydrogenase gene as a marker for studying Blastocystis genetic diversity
    Adriana Higuera, Marina Muñoz, Myriam Consuelo López, Patricia Reyes, Plutarco Urbano, Oswaldo Villalobos, Juan David Ramírez
    Heliyon.2020; 6(11): e05387.     CrossRef
  • A bite to fight: front-line innate immune defenses against malaria parasites
    Stephanie Tannous, Esther Ghanem
    Pathogens and Global Health.2018; 112(1): 1.     CrossRef
  • Genetic Diversity of Plasmodium vivax Causing Epidemic Malaria in the Republic of Korea
    Young Yil Bahk, Jeonga Kim, Seong Kyu Ahn, Byoung-Kuk Na, Jong-Yil Chai, Tong-Soo Kim
    The Korean Journal of Parasitology.2018; 56(6): 545.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Diversity of vir Genes in Plasmodium vivax from Endemic Regions in the Republic of Korea: an Initial Evaluation
Korean J Parasitol. 2017;55(2):149-158.   Published online April 30, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Diversity of vir Genes in Plasmodium vivax from Endemic Regions in the Republic of Korea: an Initial Evaluation
Korean J Parasitol. 2017;55(2):149-158.   Published online April 30, 2017
Close

Figure

  • 0
  • 1
  • 2
Diversity of vir Genes in Plasmodium vivax from Endemic Regions in the Republic of Korea: an Initial Evaluation
Image Image Image
Fig. 1 Blood collection regions. From left to right, Gimpo (GP), Paju (PJ), and Choerwon (CW) are denoted by asterisks.
Fig. 2 Sequence polymorphism of vir genes in the ROK P. vivax isolates. The polymorphic nucleotides were compared to that of Sal-1 (GenBank no.: AAKM01000041.2). (A) Sequences of vir 27 gene of isolates. (B) Sequences of vir 21 gene of ROK isolates compared with 5 Indian isolates. (C) Sequences of vir 12 gene of isolates. (D) Sequences of vir 4 gene of ROK and Indian isolates. The listed sequences are indicated by dots for identical nucleotides with sequences of Sal-1, and hyphens for gaps. The locations of polymorphic sites are represented above and the nucleotide changes are marked with colors.
Fig. 3 The phylogenetic tree of vir 4 was inferred using the minimum evolution method. The optimal tree with the sum of branch length=0.00535425 is shown.
Diversity of vir Genes in Plasmodium vivax from Endemic Regions in the Republic of Korea: an Initial Evaluation

Information of PCR ingredients used in this study

PCR primers Primer sequence Annealing temperature (°C) Subfamilya Gene lengthb (bp) Accession no.
vir 27 gene: PVX 102630 55 I 1,255 AAKM01000041.2
v27_1 TGGCATTACACTTAGCGGTAT
v27_4 TGGTGTATCTGTGTGAAGATTTG
v27_2 CATTTTGAGCACGTTCTCCTT
v27_3 TCAAGTTGTAAGGTGATCAATGAAA

vir 21 gene: PVX 115480 B 974 AAKM01000003.1
v21_1 ACAACTCATTGGTATTTACATTTATGA 55
v21_4 TGCGAAAAATAAGACGCAAA
v21_2 TTCAAAGCATAAAATTCGCACT
v21_3 TCCCAAAATAAAGGCAAGGTT

vir 12 gene: PVX 097525 E 2,548 AAKM01000016.1
v12_1 AAATATTCAAACAATGGCAATACA 55
v12_3 ACTTCCCGTGCAGGTATTTC
v12_2 TGACATAGGTAACGCATAATATAGCA

vir 4 gene: PVX 021680 C 1,314 AAKM01000104.1
v4_1 CGAAATATACTTGTCTTAACTGGTTG 55
v4_4 CAGAATGGCATCTGTTTATGC
v4_2 GACCAATATTTTGGGCAGGTT
v4_3 AGGTAGAATTGCGGCTCAGA

asubfamily of the vir gene.

bamplicon size.

PCR results of venous blood samples collected from malaria patients according to year of collection and region

Year Region Vir 27 Vir 21 Vir 12 Vir 4




+ (%) − (%) + (%) − (%) + (%) − (%) + (%) − (%)
2011 Gimpo (GP) 5 (22.7) 0 (0.0) 1 (20.0) 4 (80.0) 2 (40.0) 3 (60.0) 2 (40.0) 3 (60.0)
Paju (PJ) 1 (4.6) 1 (4.6) 1 (50.0) 1 (50.0) 1 (50.0) 1 (50.0) 0 (0.0) 2 (100.0)
Cheorwon (CW) 7 (31.8) 8 (36.3) 9 (60.0) 6 (40.0) 8 (53.3) 7 (46.7) 3 (20.0) 12 (80.0)
Total 13 (59.1) 9 (40.9) 11 (50.0) 11 (50.0) 11 (50.0) 11 (50.0) 5 (22.7) 17 (77.3)

2012 Gimpo 4 (66.6) 2 (33.3) 3 (50.0) 3 (50.0) 5 (83.3) 1 (16.7) 2 (33.3) 4 (66.7)
Paju 18 (78.3) 5 (21,7) 12 (52.2) 11 (47.8) 19 (82.6) 4 (17.4) 6 (26.1) 17 (73.9)
Cheorwon 7 (100.0) 0 (0.0) 2 (28.6) 5 (71.4) 6 (85.7) 1 (14.3) 5 (71.4) 2 (28.6)
Total 29 (80.6) 7 (20.4) 17 (47.2) 19 (52.8) 30 (83.3) 6 (16.7) 13 (36.1) 23 (63.9)

2013 Gimpo 0 0 0 0 0 0 0 0
Paju 6 (60.0) 4 (40.0) 6 (60.0) 4 (40.0) 6 (60.0) 4 (40.0) 3 (30.0) 7 (70.0)
Cheorwon 14 (82.4) 3 (17.6) 9 (52.9) 8 (47.1) 12(70.6) 5 (29.4) 5 (29.4) 12 (70.6)
Total 20 (74.1) 7 (25.9) 15 (55.6) 12 (44.4) 18 (66.7) 9 (33.3) 8 (29.6) 19 (70.4)

Total 62 (72.9) 23 (27.1) 43 (46.7) 42 (53.3) 59 (65.7) 26 (34.3) 26 (31.3) 59 (68.7)

Summary statistics for the 4 vir genes in gene level

Vir genes (No. of analyzed genes) Sequence length Segregating sites (S) No. of haplotypes (H) Haplotype diversity (Hd) Nucleotide diversity Tajima’s D test
π Θw
Vir 27 (62) 1,255 bp 10 6 0.774 0.00238 0.00171 1.08530
Vir 21 (43) 974 bp 143 22 0.827 0.04165 0.03746 0.40782
Vir 12 (59) 1,323 bp 74 9 0.795 0.03640 0.01979 2.89007a
Vir 4 (26) 1,314 bp 6 4 0.556 0.00064 0.00116 −1.32162
Average 58.25 10.25 0.738 0.02027 0.01503 0.76539

aStatistical significance, P<0.01.

Summary statistics for 4 vir genes with population

Region Vir genes (No. of analyzed genes) Sequence length Segregating sites (S) No. of haplotypes (H) Haplotype diversity (Hd) Nucleotide diversity Tajima’s D test

π Θw
Gimpo (GP) Vir 27 (9) 1,255 bp 8 4 0.778 0.00178 0.00227 −0.92403
Vir 21 (4) 974 bp 83 5 1.000 0.04544 0.04426 0.20329
Vir 12 (7) 1,323 bp 70 4 0.821 0.04043 0.03164 2.89007a
Vir 4 (4) 1,314 bp 4 2 0.400 0.00119 0.00143 −1.09380

Paju (PJ) Vir 27 (25) 1,255 bp 10 6 0.788 0.00293 0.00231 0.89090
Vir 21 (19) 974 bp 86 10 0.758 0.03489 0.02763 1.07769
Vir 12 (26) 1,323 bp 79 8 0.849 0.03658 0.02469 1.86160a
Vir 4 (9) 1,314 bp 5 3 0.644 0.00100 0.00132 −0.98485

Cheorwon (CW) Vir 27 (28) 1,255 bp 7 5 0.771 0.00236 0.00143 1.92777
Vir 21 (20) 974 bp 144 15 0.957 0.04800 0.04484 0.28890
Vir 12 (26) 1,323 bp 76 8 0.803 0.03766 0.02359 2.30545b
Vir 4 (13) 1,314 bp 6 4 0.659 0.00093 0.00141 −1.22712
Table 1 Information of PCR ingredients used in this study

subfamily of the vir gene.

amplicon size.

Table 2 PCR results of venous blood samples collected from malaria patients according to year of collection and region
Table 3 Summary statistics for the 4 vir genes in gene level

Statistical significance, P<0.01.

Table 4 Summary statistics for 4 vir genes with population

P<0.05.

P<0.01.