Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

A Novel Niosomal Combination of Selenium Coupled with Glucantime against Leishmania tropica

The Korean Journal of Parasitology 2019;57(1):1-8.
Published online: February 26, 2019

1Leishmaniasis Research Center, Kerman University of Medical Sciences, Kerman, Iran

2Department of Pharmaceutics, Faculty of Pharmacy, Kerman University of Medical Sciences, Kerman, Iran

3Department of Pediatric Dermatology, Kerman University of Medical Sciences, Kerman, Iran

4HIV/STI Surveillance Research Center, and WHO Collaborating Center for HIV Surveillance, Institute for Futures Studies in Health, Kerman University of Medical Sciences, Kerman, Iran

*Corresponding author (Khazaeli.payam97@gmail.com)
• Received: October 27, 2018   • Revised: January 16, 2019   • Accepted: January 22, 2019

Copyright © 2019 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12,324 Views
  • 241 Download
  • 19 Web of Science
  • 19 Crossref
  • 24 Scopus
next

Citations

Citations to this article as recorded by  Crossref logo
  • Development and Optimization of Dissolvable Polymeric Microneedle Patch for Transdermal Delivery of Lawsone
    Marzieh Sajadi Bami, Shayan Fakhraei Lahij, Hamid Mobedi, Mehrdad Hamidi, Reza Vahidi, Payam Khazaeli
    Jundishapur Journal of Natural Pharmaceutical Products.2026;[Epub]     CrossRef
  • A Comprehensive Review on Recent Advances and Patents of Niosomes
    Sakshi Saharawat, Sushma Verma
    Recent Patents on Nanotechnology.2025; 19(3): 364.     CrossRef
  • Promising aryl selenoate derivatives as antileishmanial agents and their effects on gene expression
    Celia Fernández-Rubio, Mercedes Rubio-Hernández, Verónica Alcolea, Aroia Burguete-Mikeo, Paul A. Nguewa, Silvia Pérez-Silanes, Audrey Odom John
    Antimicrobial Agents and Chemotherapy.2024;[Epub]     CrossRef
  • Combinational therapy with Myc decoy oligodeoxynucleotides encapsulated in nanocarrier and X-irradiation on breast cancer cells
    BEHROOZ JOHARI, MILAD PARVINZAD LEILAN, MAHMOUD GHARBAVI, YOUSEF MORTAZAVI, ALI SHARAFI, HAMED REZAEEJAM
    Oncology Research.2024; 32(2): 309.     CrossRef
  • Leishmanicidal and immunomodulatory properties of Brazilian green propolis extract (EPP-AF®) and a gel formulation in a pre-clinical model
    Jéssica Rebouças-Silva, Nathaly Alcazar Amorim, Flávio Henrique Jesus-Santos, Jéssica Aparecida de Lima, Jonilson Berlink Lima, Andresa A. Berretta, Valéria M. Borges
    Frontiers in Pharmacology.2023;[Epub]     CrossRef
  • Drug Delivery Through Niosomes: A Comprehensive Review with Therapeutic Applications
    Mishkaat Parveen Izhar, Abdul Hafeez, Poonam Kushwaha, Simrah
    Journal of Cluster Science.2023; 34(5): 2257.     CrossRef
  • Nanoemulsions for increased penetrability and sustained release of leishmanicidal compounds
    Darlyn J. García, Maritza Fernández‐Culma, Yulieth A. Upegui, Luz A. Ríos‐Vásquez, Wiston Quiñones, Rogelio Ocampo‐Cardona, Fernando Echeverri, Iván D. Vélez, Sara M. Robledo
    Archiv der Pharmazie.2023;[Epub]     CrossRef
  • Niosome as an Effective Nanoscale Solution for the Treatment of Microbial Infections
    Mahmood Barani, Fatemeh Paknia, Maryam Roostaee, Batoul Kavyani, Davood Kalantar-Neyestanaki, Narges Ajalli, Alireza Amirbeigi, Rahul Shivahare
    BioMed Research International.2023;[Epub]     CrossRef
  • Selenium and protozoan parasitic infections: selenocompounds and selenoproteins potential
    Sajad Rashidi, Celia Fernández-Rubio, Reza Mansouri, Mohammad Ali-Hassanzadeh, Esmaeel Ghani, Mohammadreza Karimazar, Raúl Manzano-Román, Paul Nguewa
    Parasitology Research.2022; 121(1): 49.     CrossRef
  • Preparation and evaluation of physicochemical properties and anti-leishmanial activity of zirconium/tioxolone niosomes against Leishmania major
    Parisa Fatehi chinar, Sina Bahraminejad, Abbas Pardakhty, Iraj Sharifi, Mahdi Ranjbar, Somayyeh Karami-Mohajeri, Fatemeh Sharifi
    Arabian Journal of Chemistry.2022; 15(10): 104156.     CrossRef
  • Unveiling a New Selenocyanate as a Multitarget Candidate with Anticancer, Antileishmanial and Antibacterial Potential
    Sandra Ramos-Inza, Andreina Henriquez-Figuereo, Esther Moreno, Melibea Berzosa, Ignacio Encío, Daniel Plano, Carmen Sanmartín
    Molecules.2022; 27(21): 7477.     CrossRef
  • Drug Encapsulation: Review of Niosomes for Promoting Antimicrobial Activity
    Tatielle do Nascimento, Denise de Abreu Garófalo, Mariana Sato de Souza Bustamante Monteiro, Ralph Santos-Oliveira, Ana Paula dos Santos Matos, Eduardo Ricci-Júnior
    Journal of Nanoparticle Research.2022;[Epub]     CrossRef
  • Niosomes-loaded selenium nanoparticles as a new approach for enhanced antibacterial, anti-biofilm, and anticancer activities
    Abbas Haddadian, Farnoush Falahi Robattorki, Hedieh Dibah, Ali Soheili, Erfan Ghanbarzadeh, Nasrin Sartipnia, Shadi Hajrasouliha, Kamal Pasban, Romina Andalibi, Mojtaba Hedayati Ch, Arezou Azari, Arman Chitgarzadeh, Aliasghar Bagheri Kashtali, Fatemeh Mas
    Scientific Reports.2022;[Epub]     CrossRef
  • Leishmaniasis and Trace Element Alterations: a Systematic Review
    Ali Taghipour, Amir Abdoli, Afifeh Ramezani, Ahmad Abolghazi, Mirza Ali Mofazzal Jahromi, Salar Maani, Seyede Manizhe Heidar Nejadi, Sima Rasti, Morteza Shams, Ezatollah Ghasemi
    Biological Trace Element Research.2021; 199(10): 3918.     CrossRef
  • New Phosphoramidates Containing Selenium as Leishmanicidal Agents
    Mikel Etxebeste-Mitxeltorena, Daniel Plano, Socorro Espuelas, Esther Moreno, Carlos Aydillo, Antonio Jiménez-Ruiz, Juan Carlos García Soriano, Carmen Sanmartín
    Antimicrobial Agents and Chemotherapy.2021;[Epub]     CrossRef
  • Niosomes: A review on niosomal research in the last decade
    Peeyush Bhardwaj, Purnima Tripathi, Rishikesh Gupta, Sonia Pandey
    Journal of Drug Delivery Science and Technology.2020; 56: 101581.     CrossRef
  • Leishmanial selenoproteins and the host immune system: towards new therapeutic strategies?
    Sajad Rashidi, Kurosh Kalantar, Paul Nguewa, Gholamreza Hatam
    Transactions of The Royal Society of Tropical Medicine and Hygiene.2020; 114(7): 541.     CrossRef
  • The potential role of nicotinamide on Leishmania tropica: An assessment of inhibitory effect, cytokines gene expression and arginase profiling
    Razieh Tavakoli Oliaee, Iraj Sharifi, Mehdi Bamorovat, Alireza Keyhani, Zahra Babaei, Ehsan Salarkia, Rahele Tavakoly, Ahmad Khosravi, Mahshid Mostafavi, Fatemeh Sharifi, Seyed Mohammad Mousavi
    International Immunopharmacology.2020; 86: 106704.     CrossRef
  • New Amides Containing Selenium as Potent Leishmanicidal Agents Targeting Trypanothione Reductase
    Mikel Etxebeste-Mitxeltorena, Daniel Plano, Socorro Espuelas, Esther Moreno, Carlos Aydillo, Antonio Jiménez-Ruiz, Juan Carlos García Soriano, Carmen Sanmartín
    Antimicrobial Agents and Chemotherapy.2020;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

A Novel Niosomal Combination of Selenium Coupled with Glucantime against Leishmania tropica
Korean J Parasitol. 2019;57(1):1-8.   Published online February 26, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
A Novel Niosomal Combination of Selenium Coupled with Glucantime against Leishmania tropica
Korean J Parasitol. 2019;57(1):1-8.   Published online February 26, 2019
Close

Figure

  • 0
  • 1
  • 2
  • 3
A Novel Niosomal Combination of Selenium Coupled with Glucantime against Leishmania tropica
Image Image Image Image
Fig. 1 Microscopic images of Span/Tween 40 (molar ratio=5:5) selenium niosome (A), and Span/Tween 40 (molar ratio=5:5) selenium plus glucantime niosome (B).
Fig. 2 Comparison of inhibitory effect selenium, selenium niosome, selenium plus glucantime niosome and glucantime plus selenium niosome, on Leishmania tropica promastigotes with glucantime as a standard drug, by MTT assay (*P<0.05).
Fig. 3 Inhibitory effect of selenium plus glucantime on promastigotes of Leishmania tropica.
Fig. 4 The gene expression profiles of (A) metacaspase, (B) IL-10, and (C) IL-12p40 on the Leishmania tropica treated by the selenium plus glucantime niosome and glucantime in comparison with untreated control (*P<0.001) as measured by using real-time PCR.
A Novel Niosomal Combination of Selenium Coupled with Glucantime against Leishmania tropica

Primers which were used for real-time PCR

Primers Gene Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Product size (bp)
Macrophages murine cells IL-12 P40 CTGGAGCACTCCCCATTCCTA GCAGACATTCCCGCCTTTG 160
IL-10 CTTACTGACTGGCATGAGGATCA GCAGCTCTAGGAGCATGTGC 101
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA 89

Promastigotes of L. tropica Metacaspase CAGCAACAATTCCTGGCGATA AAGTTTGAAGTAAAAGGAGACAATTTGG 140
RPS18 Ribosomal protein (S18) GTTGAGGTGCGTGGTCTGTC TGCAGGTTGCTCAGGAGCTT 166

Comparison of the IC50 values of selenium, selenium niosome, glucantime, glucantime plus selenium niosome and selenium plus glucantime niosome on Leishmania tropica promastigotes and amastigotes, CC50 values of drugs on macrophage and SI index

Drug Amastigote Promastigote Macrophage SI




IC50±SD (μg/ml) P-value IC50±SD (μg/ml) P-value CC50 (μg/ml) (Selectivity Index)
Glucantime 222.31±28.04 ≤0.001 144.5±97.3 ≤0.001 1634 7.35

Selenium 216.18±2.82 ≤0.001 78.07±5 ≤0.001 260.51 1.2

Selenium niosome 78.45±1.3 ≤0.001 48.2±6.2 ≤0.001 1202 15.32

Selenium plus glucantime niosome 8.67±0.1 ≤0.001 16.11±0.99 ≤0.001 1105 127.45

Glucantime plus selenium niosome 14.47±2.22 ≤0.001 42.17±2.47 ≤0.001 1511 104.42

IC50, Concentration of drug that caused 50% of growth inhibition of promastigotes and amastigotes; CC50, Concentration of drug that caused 50% of cytotoxicity on macrophages; SI (Selectivity index), the ratio between CC50 on J774 cells and IC50 against L. tropica amastigotes (SI=CC5O/IC50≥10 non-toxic).

Comparison of the overall mean effect of various concentrations of selenium, selenium niosome and, glucantime, selenium plus glucantime niosome, and glucantime plus selenium niosome on the mean number of amastigotes in macrophage

Concentration (μg/ml) Glucantime Selenium Selenium niosome Selenium plus glucantime niosome Glucantime plus selenium niosome





Mean±SD P-value Mean±SD P-value Mean±SD P-value Mean±SD P-value Mean±SD P-value
0 (Untreated control) 22±1 NR 22±0.1 NR 22±1 NR 32±0.56 NR 32±0.56 NR

12.5 21±0.26 0.51 14.7±0.1 ≤0.001 15±0.2 ≤0.001 13.95±0.13 ≤0.001 15.9±0.38 ≤0.001

25 20±0.75 0.51 13.03±0.12 ≤0.001 13±0.7 ≤0.001 13±0.1 ≤0.001 13.84±0.63 ≤0.001

50 15±0.17 ≤0.001 12.37±0.21 ≤0.001 10±0.2 ≤0.001 12.95±0.05 ≤0.001 12.85±0.27 ≤0.001

100 12±0.26 ≤0.001 11.56±0.52 ≤0.001 9±0.05 ≤0.001 11.06±0.19 ≤0.001 10.83±0.35 ≤0.001

200 10±0.62 ≤0.001 8.03±0.14 ≤0.001 8±0.7 ≤0.001 6.32±0.25 ≤0.001 6.45±0.14 ≤0.001

Comparison of the overall mean effect of various concentrations of selenium plus glucantime on the mean number of amastigotes in each macrophage

Concentrations (μg/ml) Glucantime plus selenium
Mean±SD P-value
0 (Untreated control) 36±0.38 NR
50+50 20.4±0.4 ≤0.001
50+100 19.76±0.45 ≤0.001
50+200 18.01±0.4 ≤0.001
100+50 19.7±0.3 ≤0.001
100+100 17.2±0.37 ≤0.001
100+200 13.7±0.46 ≤0.001
200+50 17.07±0.31 ≤0.001
200+100 16.2±0.41 ≤0.001
200+200 13.67±0.5 ≤0.001
Table 1 Primers which were used for real-time PCR
Table 2 Comparison of the IC50 values of selenium, selenium niosome, glucantime, glucantime plus selenium niosome and selenium plus glucantime niosome on Leishmania tropica promastigotes and amastigotes, CC50 values of drugs on macrophage and SI index

IC50, Concentration of drug that caused 50% of growth inhibition of promastigotes and amastigotes; CC50, Concentration of drug that caused 50% of cytotoxicity on macrophages; SI (Selectivity index), the ratio between CC50 on J774 cells and IC50 against L. tropica amastigotes (SI=CC5O/IC50≥10 non-toxic).

Table 3 Comparison of the overall mean effect of various concentrations of selenium, selenium niosome and, glucantime, selenium plus glucantime niosome, and glucantime plus selenium niosome on the mean number of amastigotes in macrophage
Table 4 Comparison of the overall mean effect of various concentrations of selenium plus glucantime on the mean number of amastigotes in each macrophage