Warning: mkdir(): Permission denied in /home/virtual/lib/view_data.php on line 81

Warning: fopen(upload/ip_log/ip_log_2024-05.txt): failed to open stream: No such file or directory in /home/virtual/lib/view_data.php on line 83

Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 84
Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms
| Home | E-Submission | Sitemap | Contact us |  
top_img
Korean J Parasito Search

CLOSE

Korean J Parasito > Volume 57(1):2019 > Article
Fu, Liu, Abuzeid, Huang, Zhou, He, Zhao, Li, Liu, Ran, and Li: Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms

Abstract

Melting temperature shift (Tm-shift) is a new detection method that analyze the melting curve on real-time PCR thermocycler using SYBR Green I fluorescent dye. To establish a Tm-shift method for the detection of Ancylostoma ceylanicum and A. tubaeforme in cats, specific primers, with GC tail of unequal length attached to their 5′ end, were designed based on 2 SNP loci (ITS101 and ITS296) of the internal transcribed spacer 1 (ITS1) sequences. The standard curve of Tm-shift was established using the standard plasmids of A. ceylanicum (AceP) and A. tubaeforme (AtuP). The Tm-shift method stability, sensitivity, and accuracy were tested with reference to the standard curve, and clinical fecal samples were also examined. The results demonstrated that the 2 sets of primers based on the 2 SNPs could accurately distinguish between A. ceylanicum and A. tubaeforme. The coefficient of variation (CV) of Tm-values of AceP and AtuP was 0.07% and 0.06% in ITS101 and was 0.06% and 0.08% in ITS296, respectively. The minimum detectable DNA concentration was 5.22×10−6 and 5.28×10−6 ng/μl samples of AceP and AtuP, respectively. The accuracy of Tm-shift method reached 100% based on examination of 10 hookworm DNA samples with known species. In the clinical detection of hookworm in 69 stray cat fecal sample, the Tm-shift detection results were consistent with the microscopic examination and successfully differentiated between the 2-hookworm species. In conclusion, the developed method is a rapid, sensitive and accurate technique and can provide a promising tool for clinical detection and epidemiological investigation of cat-derived hookworms.

INTRODUCTION

Hookworms are common parasitic nematodes in the digestive tract of human beings, dogs and cats, which can cause a serious hazard to the host. The main hookworms infecting cats include Ancylostoma ceylanicum, A. tubaeforme, A. braziliense, and Uncinaria stenocephala. The recent investigations have shown that the cat’s hookworm infection in China is mainly caused by A. ceylanicum and A. tubaeforme [1,2]. A. ceylanicum is globally distributed among dogs and cats, however it is particularly severe in Asia, especially in Southeast Asia and the Pacific. Recently, A. ceylanicum has been recorded in many Southeast Asian countries, such as China [3,4], Japan [5], Malaysia [6], Laos [7], Thailand [8]. A. tubaeforme mainly infects cats, but it is rarely reported in canines. According to the previous surveys, A. tubaeforme has been reported in cats in Australia [9,10], Brazil [11], Italy [12], Qatar [13], Spain [14], the United States [15,16], and China [2]. Currently, A. ceylanicum has become the second largest species of hookworm in Asia [17], that can feed on blood and develop into adults in the human body, causing anemia, abdominal pain, diarrhea, and even death. As the number of cat owners increases, it is important to establish a rapid and accurate method that can distinguish A. ceylanicum from A. tubaeforme to enhance public health and safety.
The fecal examination is a classical method for hookworm detection, but it fails to identify hookworm species. Therefore, it is difficult to judge whether the infection is caused by A. ceylanicum. Presently, many molecular detection techniques have been applied to identify hookworms, such as specific polymerase chain reaction (PCR), multiplex PCR, restriction fragment length polymorphism (RFLP) and high-resolution melting (HRM) analysis [1820]. All the former techniques have certain limitations, some can only detect a small number of samples at the same time, and others are complicated and expensive to operate.
Melting temperature shift (Tm-shift) method based on single nucleotide polymorphism (SNP) is a new molecular detection technique, which is high-throughput, accurate and inexpensive. This method utilizes 2 allele-specific primers, each of which attach to one of the two SNP loci at its 3′ end, a reverse primer that amplifies both alleles, and a fluorescent dye, SYBR® Green I (Molecular Probes, Eugene, Oregon, USA). Either one or both allele specific primer(s) amplify according the sample genotype. GC rich tails of unequal length are attached to the 5′ end of the allele-specific primers, so that the PCR product has a different melting temperature depending on which of the 2 primers is used. Therefore, genotypes can be distinguished by checking the melting curve on a real-time PCR instrument [21,22]. The Tm-shift method has been applied in many fields, such as medicine, microbiology, and aquatic biology [2325]. In our laboratory, Pan et al. [26] established a Tm-shift genotyping method for Giardia lamblia assemblages A and F in cats, which pioneered a new genotyping method for veterinary parasitic protozoa. In addition, Fu et al. [27] developed a Tm-shift detection method for A. ceylanicum and A. caninum in dogs and applied it for the first time to identify veterinary parasitic nematode.
The present study aimed to develop and evaluate a Tm-shift method for the identification of A. ceylanicum and A. tubaeforme in cats, to provide a fast and accurate technique for the clinical detection and zoonotic risk assessment of cat-derived hookworms.

MATERIALS AND METHODS

Source of samples

Adult A. ceylanicum and A. tubaeforme samples were isolated and identified by Liu et al. [4] and Shi et al. [2], and preserved in 50% ethyl alcohol in our laboratory. Fecal samples were collected from stray cats at the Animal Rescue Station in Shaoguan city of Guangdong province in China and stored at 4°C.

Genomic DNA extraction

The preserved adult hookworms were repeatedly washed with double-distilled water (ddH2O). After that, the genomic DNA was extracted using the Wizard® SV Genomic DNA Purification System (Promega, Guangzhou, China) according to the manufacturer’s instructions, then stored at −20°C.

PCR amplification of ITS1 sequence

The extracted DNA was subjected to polymerase chain reaction targeting A. ceylanicum and A. tubaeforme internal transcribed spacer 1 (ITS1) sequences using a forward primer AF (5′-CTTTGTCGGGAAGGTTGG-3′) and a reverse primer AR (5′-TTCACCACTCTAAGCGTCT-3′) previously designed by Liu et al. [4]. The target amplification fragment length was 404 bp. PCR was carried out in a final volume of 25 μl, containing 12.5 μl Premix Ex-Taq polymerase (TaKaRa, Dalian, China), 9.5 μl ddH2O, 0.5 μl of each primer AF/AR (50 μmol/L), and 2 μl DNA template. The utilized PCR program was as follows: 94°C for 5 min, 35×(94°C for 30 sec, 61.5°C for 30 sec and 72°C for 45 sec), and 72°C for 7 min. The PCR products were assessed by electrophoresis in agarose gel (1.5%) with ethidium bromide stain (0.2 mg/ml) and visualized on a UV transilluminator. The amplified fragment was recovered from the gel following the protocol of the gel recovery kit (Omega, Guangzhou, China) and kept at −20°C until further use.

Preparation of standard plasmids

The purified PCR products were cloned in Escherichia coli and connected with pMD18-T vector (TaKaRa), then transformed into DH5 Competent Cells (TaKaRa). Positive clones were screened by bacterial PCR and sent to Sangon Biotech (Shanghai, China) for sequencing. The Plasmid Kit (Omega) was used to extract the plasmid DNAs. The plasmids harboring A. ceylanicum and A. tubaeforme ITS1 sequences were termed as AceP and AtuP. The plasmids (1 μl) were analyzed by the ultramicro-spectrophotometer to evaluate their purity and concentration, where A260/A280 value and optimal concentration should be 1.8–2.0 and 50 ng/μl, respectively.

Establishment of Tm-shift method based on SNP

Based on the 2 SNPs (ITS101 and ITS296), 2 sets of Tm-shift primers were designed using Primer Premier 5.0 software, referencing to the 2 sequences (MG733992, KP072069) downloaded from GenBank. The primer sequences and predicted amplification fragment length are demonstrated in Table 1. The above-mentioned primers were synthesized by Sangon Biotech (Shanghai, China). The synthesized primers were prepared in a template liquid at 100 pmol/μl and stored at −20°C. Then they were re-diluted to a final working concentration of 10 pmol/μl and stored at −20°C for use after partial shipments. PCR amplification and Tm-shift reaction were performed once in Rotor-Gene Q. The qPCR-Tm-shift reaction mixture had the final volume of 20 μl, containing 2×SYBR® Premix Ex Taq TM II (10 μl), long-tail primer (0.4 μl), short-tail primer (0.4 μl), common reverse primer (0.8 μl), ddH2O (7.4 μl), and plasmid (1.0 μl). The cycling program was as follows: 95°C for 5 min, 40×(95°C for 10 sec and 63°C for 30 sec). The melting process ranged from 70 to 95°C at the rate of 0.5°C/sec.

Stability, sensitivity and accuracy test

The stability of the established Tm-shift method was detected by repeating the experiments using 2 standard plasmids (AceP and AtuP). Intra-assay was checked 7 times, while inter-assay was checked 3 times for each plasmid. To evaluate the Tm-shift method sensitivity, AceP and AtuP were diluted 10 times and examined following the concentration of 1:10–1:108. To assess the Tm-shift method accuracy, 10 samples with known hookworm species were examined. The qPCR-Tm-shift reaction mixture and cycling program were identical to the mentioned above.

Clinical detection

Sixty-nine stray cat fecal samples were analyzed by zinc sulfate flotation technique and Tm-shift method. All fecal samples were suspended in ddH2O, heated for 5 cycles at 100°C for 5 min and immediately frozen at −80°C for 5 min. Genomic DNAs were extracted from the fecal samples using Stool DNA extraction kit (OMEGA, Guangzhou, China) as indicated by the manufacturer’s protocols. The qPCR-Tm-shift reaction mixture and cycling program were the same as the mentioned above. All results were further confirmed by DNA sequencing.

RESULTS

Amplification of ITS1 fragment and preparation of standard plasmids

The amplification of the 2-hookworm species ITS1 sequences produced fragments with the length of 404 bp (Fig. 1), which agreed with the expected fragment length. The generated sequence data were submitted to GenBank (accession number: KF279132, JO812691). BLAST analysis showed the highest similarity (100%) with A. ceylanicum from Japan (LC036567) and the highest similarity (100%) with A. tubaeforme from Guangzhou (MG865903). Thus, 2 hookworms were identified as A. ceylanicum and A. tubaeforme. The A260/A280 values of positive plasmids of A. ceylanicum (AceP) and A. tubaeforme (AtuP) were between 1.8 and 2.0. In addition, the concentration of AceP and AtuP was 53.3 and 50.3 ng/μl, respectively, which was consistent with the optimal criteria.

Detection of qPCR-Tm-shift

The Tm-shift standard curves based on the 2 SNPs (ITS101 and ITS296) for standard plasmid AceP and AtuP are revealed in Fig. 2. The result showed that the established Tm-shift method could distinguish A. ceylanicum (AceP) from A. tubaeforme (AtuP). The analysis of the standard curves by Rotor-Gene Q series software demonstrated that in the ITS101 primer, the Tm values of AceP and AtuP were 88.25°C and 86.50°C, respectively. In the ITS296 primer, the Tm values of AceP and AtuP were 85.00°C and 86.60°C, respectively.

Stability, sensitivity and accuracy

The stability test results are presented in Table 2. In the primer ITS101, the coefficient of variation (CV) of AceP and AtuP melting temperature (Tm) was 0.07% and 0.06%, respectively. In primer ITS296, the CV of AceP and AtuP melting temperature was 0.06% and 0.08%, respectively. The sensitivity test results indicated that the Tm-shift method could still differentiate between A. ceylanicum (AceP) and A. tubaeforme (AtuP), when they were diluted to 1:107 (5.22×10−6 ng/μl and 5.28×10−6 ng/μl, respectively) (Table 3). The results of examination of 10 DNA samples by Tm-shift method were identical to their known hookworm species with 100% accuracy (Table 4).

Clinical detection

Twelve out of 69 cat fecal samples were positive for hookworm by the fecal flotation and Tm-shift methods. Using Tm-shift method, 8 and 4 samples were identified as A. ceylanicum and A. tubaeforme, respectively. The melting curves and detection results are shown in Fig. 3. All detection results were identical to the sequencing results.

DISCUSSION

Ancylostoma ceylanicum and A. tubaeforme are the 2 most common parasitic nematodes in cats. The former is the only animal-derived hookworm that can cause severe infection in humans. In Malaysia, the infection rate of A. ceylanicum is as high as 23.4%, which has become the second largest hookworm in local people [28]. In Laos, one-third of human hookworm infections are caused by A. ceylanicum [29]. Also, there are reports of human infection with A. ceylanicum in Taiwan [30]. In recent years, many cases of cat infection with A. tubaeforme have been detected in Guangzhou, China [2]. With the economic development and life quality improvement, more and more people are raising cats. Hence, it is of great significance to establish a Tm-shift detection method for cat-derived A. ceylanicum and A. tubaeforme for the prevention and control of zoonotic hookworm disease.
Common molecular biological methods for hookworm species identification include polymerase chain reaction (PCR), multiplex PCR, restriction fragment length polymorphism (RFLP), and high-resolution melting curve (HRM) [1820]. Although the first 3 methods are specific and sensitive, they require gel electrophoresis after PCR, which makes the samples can be easily contaminated. In addition, the long-term use of ethidium bromide may seriously endanger the health of the operator. As a new molecular detection method, Tm-shift method is simple and quick to operate compared with the above-mentioned methods. The Tm-shift method is completed at one time on a closed fluorescent PCR instrument minimizing the contamination risk. As well as, it can examine 36 or 72 samples at the same time. Compared with HRM, the Tm-shift method does not require a relatively complicated HRM program. The used fluorescent dye in Tm-shift method is the ordinary SYBR Green I fluorescent dye, which is less expensive than the saturated dye required for HRM. Furthermore, the Tm-shift method can complete the amplification of the target fragment by using a 2-step method instead of 3 steps in HRM, which greatly saves the experiment time and improves the detection efficiency.
Even though the Tm-shift detection method has clear benefits over the other methods, it has some limitations during application. For example, the Tm-shift method has higher requirements for the design of 2 specific primers. The Tm value of the specific primer should be between 59°C and 62°C, and the primer length should be controlled in 15–22 bp. For a higher Taq polymerase amplification efficiency, the difference of Tm value between the reverse and specific primer (before adding sequences at the 5′ end) should be ranged from 4 to 5°C. In our study during the establishment of Tm-shift detection methods for cat-derived A. ceylanicum and A. tubaeforme, the primers were optimized where the short chain “gcggcg” was replaced with “gattaccg”. The results showed that this operation increased the Tm value of 2 melting curves to some extent. The difference between the peak of the melting curve for the 2 hookworms was 1.75°C at ITS101, while it was 1.60°C at ITS296. The established Tm-shift detection method was applied to examine 69 stray cat fecal samples in Shaoguan, Guangdong. The examination results of clinical fecal samples showed that 12 samples were positive for hookworm, from which 8 samples were A. ceylanicum and 4 samples were A. tubaeforme. The positive rate of Tm-shift method was consistent with the microscopic examination results, and this method could distinguish A. ceylanicum from A. tubaeforme. These results indicated that the designed Tm-shift method is rapid, accurate, efficient and sensitive.
It could be concluded that the developed Tm-shift method based on the 2 SNPs loci of ITS1 sequence can successfully identify A. ceylanicum and A. tubaeforme species. As well as, it can provide a suitable technical mean for clinical diagnosis and zoonotic risk judgment of cat-derived hookworms.

ACKNOWLEDGMENT

This work was supported by a grant from National Natural Science Foundation of China (grant no. 31672541) and the Science and Technology Planning Project of Guangdong Province, China (grant no. 2014A020214005).

Conflict of interest

CONFLICTS OF INTEREST
The authors declare that they have no conflicts of interest.

REFERENCES

1. Hu W, Wu S, Yu XG, Tan LP, Song MR, Abdulahi AY, Wang Z, Jiang B, Li GQ. Levels of Ancylostoma infections and phylogenetic analysis of cox 1 gene of A. ceylanicum in stray cat faecal samples from Guangzhou, China. J Helminthol 2015;90:392-397.
crossref pmid
2. Shi XL, Fu YQ, Abdullahi AY, Wang MW, Yang F, Yu XG, Pan WD, Yan XX, Hang JX, Zhang P, Li GQ. The mitochondrial genome of Ancylostoma tubaeforme from cats in China. J Helminthol 2018;92:22-33.
crossref pmid
3. Chen J, Xu MJ, Zhou DH, Song HQ, Wang CR, Zhu XQ. Canine and feline parasitic zoonoses in China. Parasite Vectors 2012;5:e152.
crossref
4. Liu YJ, Zheng GC, Zhang P, Alsarakibi M, Zhang XH, Li YW, Liu T, Ren SN, Chen ZX, Liu YL, Li SJ, Li GQ. Molecular identification of hookworms in stray and shelter dogs from Guangzhou city, China using ITS sequences. J Helminthol 2015;89:196-202.
crossref pmid
5. Kaya D, Yoshikawa M, Nakatani T, Tomo-oka F, Fujimotoa Y, Ishida K, Fujinaga Y, Aihara Y, Nagamatsu S, Matsuo E, Tokoro M, Ouji Y, Kikuchi E. Ancylostoma ceylanicum hookworm infection in Japanese traveler who presented chronic diarrhea after return from Lao People’s Democratic Republic. Parasitol Int 2016;65:737-740.
crossref pmid
6. Ngui R, Ching LS, Kai TT, Roslan MA, Lim YA. Molecular identification of human hookworm infections in economically disadvantaged communities in Peninsular Malaysia. Am J Trop Med Hyg 2012;86:837-842.
crossref pmid pmc
7. Conlan JV, Khamlome B, Vongxay K, Elliot A, Pallant L, Sripa B, Blacksell SD, Fenwick S, Thompson RC. Soil-Transmitted Helminthiasis in Laos: a community-wide cross-sectional study of humans and dogs in a mass drug administration environment. Am J Trop Med Hyg 2012;86:624-634.
crossref pmid pmc
8. Traub RJ, Inpankaew T, Sutthikornchai C, Sukthana Y, Thompson RC. PCR-based coprodiagnostic tools reveal dogs as reservoirs of zoonotic ancylostomiasis caused by Ancylostoma ceylanicum in temple communities in Bangkok. Vet Parasitol 2008;155:67-73.
crossref pmid
9. Wilson-Hanson SL, Prescott CW. A survey for parasites in cats. Aust Vet J 1982;59:194.
crossref pmid
10. Meloni BP, Thompson RC, Hopkins RM, Reynoldson JA, Gracey M. The prevalence of Giardia and other intestinal parasites in children, dogs and cats from aboriginal communities in the Kimberley. Med J Aust 1993;158:157-159.
pmid
11. Labarthe N, Serrão ML, Ferreira AM, Almeida NK, Guerrero J. A survey of gastrointestinal helminths in cats of the metropolitan region of Rio de Janeiro, Brazil. Vet Parasitol 2004;123:133-139.
crossref pmid
12. Riggio F, Mannella R, Ariti G, Perrucci S. Intestinal and lung parasites in owned dogs and cats from central Italy. Vet Parasitol 2013;193:78-84.
crossref pmid
13. Abu-Madi MA, Behnke JM, Prabhaker KS, Al-Ibrahim R, Lewis JW. Intestinal helminths of feral cat populations from urban and suburban districts of Qatar. Vet Parasitol 2010;168:284-292.
crossref pmid
14. Calvete C, Lucientes J, Castillo JA, Estrada R, Gracia MJ, Peribáñez MA, Ferrer M. Gastrointestinal helminth parasites in stray cats from the mid-Ebro Valley, Spain. Vet Parasitol 1998;75:235-240.
crossref pmid
15. Anderson TC, Foster GW, Forrester DJ. Hookworms of feral cats in Florida. Vet Parasitol 2003;115:19-24.
crossref pmid
16. Gates MC, Nolan TJ. Endoparasite prevalence and recurrence across different age groups of dogs and cats. Vet Parasitol 2009;166:153-158.
crossref pmid pmc
17. Traub RJ. Ancylostoma ceylanicum, a re-emerging but neglected parasitic zoonosis. Int J Parasitol 2013;43:1009-1015.
crossref pmid
18. Hu W, Wu S, Yu X, Abullahi AY, Song M, Tan L, Wang Z, Jiang B, Li G. A multiplex PCR for simultaneous detection of three zoonotic parasites Ancylostoma ceylanicum, A. caninum, and Giardia lamblia Assemblage A. BioMed Res Int 2015;2015:e406168.

19. Liu Y, Zheng G, Alsarakibi M, Zhang X, Hu W, Lu P, Lin L, Tan L, Luo Q, Li G. Molecular identification of Ancylostoma caninum isolated from cats in Southern China based on complete ITS sequence. BioMed Res Int 2013;2013:e868050.

20. Ngui R, Lim YA, Chua KH. Rapid detection and identification of human hookworm infections through high resolution melting (HRM) analysis. PLoS One 2012;7:e41996.
crossref pmid pmc
21. Germer S, Higuchi R. Single-tube genotyping without oligonucleotide probes. Genome Res 1999;9:72-78.
pmid pmc
22. Wang J, Chuang K, Ahluwalia M, Patel S, Umblas N, Mirel D, Higuchi R, Germer S. High-throughput SNP genotyping by single-tube PCR with T m-shift primers. Biotechniques 2005;39:885-893.
crossref pmid
23. Huang Y, Nie S, Zhou S, Li K, Sun J, Zhao J, Fei B, Wang Z, Ye H, Hong Q, Duan S. PPARD rs2016520 polymorphism and circulating lipid levels connect with brain diseases in Han Chinese and suggest sex-dependent effects. Biomed Pharmacother 2015;70:7-11.
crossref pmid
24. Derzelle S, Mendy C, Laroche S, Madani N. Use of high-resolution melting and melting temperature-shift assays for specific detection and identification of Bacillus anthracis based on single nucleotide discrimination. J Microbiol Methods 2011;87:195-201.
crossref pmid
25. Ahn JJ, Kim Y, Hong JY, Kim GW, Kim SY, Hwang SY. Probebased fluorescence melting curve analysis for differentiating Larimichthys polyactis and Larimichthys crocea . Food Anal Methods 2016;9:2036-2041.
crossref pdf
26. Pan W, Fu Y, Abdullahi AY, Wang M, Shi X, Yang F, Yu X, Yan X, Zhang P, Hang J, Li GQ. Development of T m-shift genotyping method for detection of cat-derived Giardia lamblia . Parasitol Res 2017;116:1151-1157.
crossref pmid pdf
27. Fu Y, Wang M, Yan X, Abdullahi AY, Hang J, Zhang P, Huang Y, Liu Y, Sun Y, Ran R, Li GQ. T m-Shift detection of dog-derived Ancylostoma ceylanicum and A. caninum . BioMed Res Int 2018;2018:e7617094.

28. Ngui R, Lim YA, Traub R, Mahmud R, Mistam MS. Epidemiological and genetic data supporting the transmission of Ancylostoma ceylanicum among human and domestic animals. PLoS Negl Trop Dis 2012;6:e1522.
crossref pmid pmc
29. Conlan JV, Sripa B, Attwood S, Newton PN. A review of parasitic zoonoses in a changing Southeast Asia. Vet Parasitol 2011;182:22-40.
crossref pmid
30. Hsu YC, Lin JT. Images in clinical medicine. Intestinal infestation with Ancylostoma ceylanicum . New Engl J Med 2012;366:e20.
crossref pmid

Fig. 1
PCR amplification of the ITS1 sequence of 2 hookworms. M, DL-500 DNA marker; 1, Positive control; 2, A. ceylanicum; 3, A. tubaeforme; 4, Negative control.
kjp-57-1-9f1.jpg
Fig. 2
Standard curves of Tm-shift for 2 hookworm standard plasmids based on ITS101 (A) and ITS296 (B). AceP, A. ceylanicum standard plasmid; AtuP, A. tubaeforme standard plasmid; Neg, negative control.
kjp-57-1-9f2.jpg
Fig. 3
Melting curve of Tm-shift based on ITS101 (A) and ITS296 (B) and detection results for 12 hookworm-positive samples.
kjp-57-1-9f3.jpg
Table 1
Primers for Tm-shift method based on 2 SNPs
Primer Nucleotide sequence (5′-3′) Product length (bp)
ITS101AF (Atu) gattaccg GGCGGCAGTGATTGCTGTA
ITS101GF (Ace) gcgggcagggcggg GGCGGCAGTGATTGCTGTG 106
ITS101R GCCTAATGCTCAACCACCAACA
ITS296TF (Ace) gattaccg TTTGCAGAATCGTGACTTT
ITS296AF (Atu) gcgggcagggcggg TTTGCAGAATCGTGACTTA 127
ITS296R TTCACCACTCTAAGCGTCT

GC tails are underlined.

Table 2
Stability of Tm-shift method
Repeat ITS101 (Tm) (°C) ITS296 (Tm) (°C)


AtuP AceP AtuP AceP
First (n=7) 86.49±0.09 88.25±0.10 86.63±0.07 85.01±0.09

Second (n=7) 86.47±0.07 88.21±0.06 86.60±0.10 85.04±0.06

Third (n=7) 86.44±0.09 88.26±0.11 86.59±0.11 85.00±0.10

Average (n=21) 86.47 88.24 85.00 86.60

CV (%) 0.06 0.07 0.08 0.06
Table 3
Sensitivity of Tm-shift method
Dilution ITS101 (Tm) (°C) ITS296 (Tm) (°C)


AtuP AceP AtuP AceP
1:101 86.50 88.25 86.60 85.00

1:102 86.50 88.25 86.65 85.00

1:103 86.50 88.35 86.60 84.90

1:104 86.50 88.35 86.60 85.00

1:105 86.40 88.15 86.50 85.00

1:106 86.40 88.25 86.60 85.10

1:107 86.40 88.25 86.60 85.10

1:108 - - - -

-, Not detected.

Table 4
The accuracy of Tm-shift method
Sample Species ITS101 (Tm) (°C) ITS296 (Tm) (°C) GenBank
M6 A. ceylanicum 88.25 85.00 KF279134
M55 A. ceylanicum 88.25 85.00 KF279135
M58 A. ceylanicum 88.25 85.00 KF279136
M60 A. ceylanicum 88.35 85.00 KF279137
M76 A. ceylanicum 88.25 85.10 KF279138
C1 A. tubaeforme 86.50 86.60 MG904956
C2 A. tubaeforme 86.50 86.60 MG904957
C3 A. tubaeforme 86.40 86.60 MG904958
C4 A. tubaeforme 86.50 86.60 MG904959
C5 A. tubaeforme 86.40 86.50 MG904960

Sample M6, M55, M58, M60, M76 were isolated and identified by Liu et al. [4]. The sequences of sample C1, C2, C3, C4, and C5 have been uploaded to GenBank.

TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
XML Download  XML Download
Full text via DOI  Full text via DOI
Download Citation  Download Citation
  Print
Share:      
METRICS
3
Web of Science
2
Crossref
3
Scopus
6,575
View
96
Download
Editorial Office
Department of Molecular Parasitology, Samsung Medical Center, School of Medicine, Sungkyunkwan University,
2066 Seobu-ro, Jangan-gu, Suwon 16419, Gyeonggi-do, Korea.
Tel: +82-31-299-6251   FAX: +82-1-299-6269   E-mail: kjp.editor@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © 2024 by The Korean Society for Parasitology and Tropical Medicine.     Developed in M2PI