Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri

Parasites, Hosts and Diseases 2026;64(1):27-36.
Published online: January 26, 2026

1Department of Biomedical Science, Graduate School, Kyung Hee University, Seoul, Korea

2Department of Medical Zoology, Kyung Hee University School of Medicine, Seoul, Korea

3Medical Research Center for Bioreaction to Reactive Oxygen Species and Biomedical Science Institute School of Medicine, Graduate School, Kyung Hee University, Seoul, Korea

4Department of Parasitology, Dong-A University College of Medicine, Busan, Korea

*Correspondence ekmoon@khu.ac.kr

These authors contributed equally to this work.


Citation Jo HJ, Lee HA, Quan FS, Kong HH, Moon EK. Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri. Parasites Hosts Dis 2026;64(1):27-36.

• Received: July 31, 2025   • Accepted: November 12, 2025

© 2026, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 1,605 Views
  • 35 Download
prev next
  • Naegleria fowleri is a free-living amoeba that can cause primary amebic meningoencephalitis (PAM), a very serious infection of the central nervous system. Early diagnosis of PAM is challenging, and the condition is almost always fatal. In this study, we conducted 2-dimensional gel electrophoresis (2-DE) analysis using N. fowleri trophozoite lysates and conditioned media to identify preferentially secreted proteins. As a result of the 2-dimensional gel electrophoresis analysis, 1 protein was found to increase, 5 proteins were found to decrease, 3 proteins showed a qualitative increase, and 15 proteins showed a qualitative decrease in the conditioned media compared to the proteins in the trophozoite lysates. Using cDNA from N. fowleri, Acanthamoeba castellanii, and Balamuthia mandrillaris, all of which can cause encephalitis, real-time PCR was performed on 5 genes corresponding to the p23-like domain-containing protein, cystatin-like domain-containing protein, fowlerpain-2, hemerythrin family non-heme iron protein, and an uncharacterized protein. The results showed that all 5 genes were highly expressed in N. fowleri. In animal models infected with N. fowleri resulting in PAM, real-time PCR analysis of brain tissue revealed significant overexpression of the p23-like domain-containing protein and fowlerpain-2. These results suggest that the 2 secreted proteins could provide valuable insights for developing antibody-based or molecular diagnostic methods to detect N. fowleri in patients with PAM.
Primary amebic meningoencephalitis (PAM) is a rare but deadly disease caused by an infection with Naegleria fowleri in the human body [1,2]. N. fowleri are free-living amoebae that inhabit warm freshwater environments such as hot springs, ponds, rivers, and lakes [3]. Naegleria infection can occur through activities such as swimming in freshwater, washing the nasal cavity with unsterilized water, or, in rare cases, using recreational waters such as poorly managed swimming pools and surf parks [4,5]. Generally, N. fowleri is introduced through the nasal cavity, travels through the olfactory nerve to the brain, and destroys central nervous system tissues. Symptoms often develop within 24 h to 1 week of infection, frequently leading to death [6,7]. Due to global warming, the risk of infection is increasing worldwide as the environments where N. fowleri can thrive are expanding [8]. Currently, there is no definitive treatment, and the clinical symptoms of PAM and bacterial meningitis are very similar, complicating rapid and accurate treatment [9]. PAM was first reported in the 1960s, and its incidence rate has been gradually increasing [10]. Therefore, it is crucial to quickly and accurately diagnose this deadly disease at an early stage.
Currently, PAM diagnosis is performed using CT or MRI to identify brain lesions such as diffuse cerebral edema, followed by cerebrospinal fluid (CSF) collection for microscopic examination. This examination uses Wright-Giemsa stain, hematoxylin and eosin stain, and periodic acid-Schiff stain, or involves culturing CSF and brain tissue [11]. Additionally, real-time PCR or PCR is used to diagnose N. fowleri infection in CSF samples [12,13]. However, these methods require specialized expertise and equipment and are time-consuming, making early diagnosis challenging [14,15]. Therefore, there is a need for a diagnostic method that is quick, accurate, and easy to perform.
Several studies have focused on secreted proteins as targets for vaccine development, treatment, and diagnosis of amoeba infections. One study compared protein expression profiles between axenically cultured low-virulence amoebae and mouse-passaged high-virulence amoebae using 2-dimensional gel electrophoresis (2-DE) and liquid chromatography–tandem mass spectrometry (LC-MS/MS) to identify potential therapeutic targets for limiting PAM. Proteins such as RhoA signaling-related proteins, heat shock protein 70, and Mp2CL5 were found to be associated with high virulence, suggesting that the pathogenicity of N. fowleri involves multiple proteins that facilitate host cell invasion [16]. In another study, proteins related to pathogenicity among N. fowleri excretory–secretory proteins were identified. Proteins were separated by 2-DE and reacted with N. fowleri infection or immune sera to identify immunodominant excretory–secretory proteins, leading to the identification of 6 proteins expected to play important roles in the pathogenicity of N. fowleri [17]. Another study analyzed the electrophoretic patterns of membrane proteins from N. fowleri and compared them with those from N. lovaniensis and N. gruberi, which are known to be nonpathogenic Naegleria species. This study aimed to identify a membrane protein, Nf23, that may be involved in the virulence of N. fowleri [18]. In another study, extracellular vesicles secreted by N. fowleri were reported to act as pathogenic factors that trigger host inflammatory responses [19]. However, research on the development of antibodies preferentially expressed in N. fowleri for its detection remains limited.
In this study, we investigated secreted proteins of N. fowleri that could be useful for producing antibodies capable of preferentially detecting N. fowleri. To achieve this, we compared the proteins present in the lysate of N. fowleri trophozoites with those in the cell-conditioned media using 2-DE analysis to identify proteins secreted by N. fowleri. We then confirmed the gene expression of those proteins using real-time PCR.
Ethics statement
All experiments involving animals were conducted in adherence to the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. The study was approved by the Kyung Hee University Institutional Animal Care and Use Committee (approval No. KHSASP-24-681).
Cell cultures
N. fowleri (ATCC 30894), Acanthamoeba castellanii (ATCC 30868), and Balamuthia mandrillaris (ATCC 50209) were obtained from the American Type Culture Collection. Vero cells were sourced from the Korean Cell Line Bank. N. fowleri were axenically cultured in Nelson’s medium (4 mg/L MgSO4•7H2O, 4 mg/L CaCl2•2H2O, 142 mg/L Na2HPO4, 136 mg/L KH2PO4, 120 mg/L NaCl, 1.7 g/L liver infusion, and 1.7 g/L glucose) at 37°C. A. castellanii were cultured in peptone-yeast-glucose medium (20 g/L proteose peptone, 1 g/L yeast extract, 0.1 M glucose, 4 mM MgSO4, 0.4 mM CaCl2, 3.4 mM sodium citrate, 0.05 mM Fe(NH4)2(SO4)2, 2.5 mM Na2HPO4, and 2.5 mM KH2PO4) at 25°C. Vero cell were cultured in RPMI 1640 medium (WelGENE) with 10% fetal bovine serum (GenDEPOT) in a 37°C incubator with 5% CO2. When the Vero cell monolayer reached approximately 80% confluency, the culture supernatant was carefully aspirated, and B. mandrillaris was inoculated onto the monolayer along with fresh culture medium.
Sample preparation and 2-DE analysis
N. fowleri trophozoites were detached from the culture flask and centrifuged at 2,000 rpm for 5 min. Protein extracts were prepared by lysing samples in a denaturing buffer (7 M urea, 2 M thiourea, 4% CHAPS, 2.5% DTT, and protease inhibitors), followed by homogenization and clarification through centrifugation at 15,000 g for 20 min. Conditioned media from N. fowleri were collected after 7 days of cultivation and concentrated using an Amicon Ultra-4 Centrifugal Filter Unit (Merck KGaA) at 3,000 rpm for 10 min. Protein concentration was measured using Bradford assay. For 2-DE, 600 µg of each sample was applied to pH 4-7 immobilized pH gradient strips (GE Healthcare Life Sciences), focused using an IPGphor III system, and then separated on 10% SDS-PAGE gels. Gels were fixed in 40% methanol containing 5% phosphoric acid, stained with Colloidal Coomassie Blue G-250, destained in water, and scanned for imaging. Spot detection and matching (with at least 25 landmarks per gel) were performed with ImageMaster 2D Platinum software (Amersham Biosciences).
LC-MS/MS for protein analysis
Protein spots from SDS-PAGE gels were excised and cut into pieces. These gel pieces were washed for 1 h in a solution of 25 mM ammonium bicarbonate buffer (pH 7.8) containing 50% acetonitrile. After dehydration in a centrifugal vacuum concentrator for 10 min, gel pieces were rehydrated in 50 ng of sequencing-grade trypsin solution (Promega). Following an overnight incubation at 37°C in 25 mM ammonium bicarbonate buffer, the tryptic peptides were extracted with 5 μl of 0.5% formic acid with 50% acetonitrile for 40 min under mild sonication. The extracted solution was concentrated using a centrifugal vacuum concentrator.
LC-MS/MS analysis was conducted using an agilent 1100 series nano-LC coupled with an LTQ mass spectrometer (Thermo Electron). Peptides were separated on a 150 mm × 75 μm Magic C18 capillary column (Proxeon). The mobile phase for liquid chromatography consisted of 2 solutions: mobile phase A was 0.1% formic acid in water, and mobile phase B was 0.1% formic acid in acetonitrile. A linear gradient was applied, starting from 6% to 50% of mobile phase B over 22 min, then ramping to 95% B over 5 min, before returning to 6% B over the next 13 min.
For tandem mass spectrometry, mass spectra were acquired using data-dependent acquisition with a full mass scan range of 350–1,800 m/z followed by MS/MS of the top precursors (1 microscan, normalized collision energy 35%). The ion transfer tube was set at 200°C, and the spray voltage was between 1.5 and 2.0 kV. Raw spectra were processed using SEQUEST (Thermo Quest) and searched against an in-house database using MASCOT (Matrix Science Ltd.). The MS analyses included modifications of methionine oxidation, cysteine alkylation, arginine methylation, and serine/threonine/tyrosine phosphorylation. The peptide mass tolerance was set at 10 ppm with an MS/MS ion mass tolerance of 0.8 Da. An allowance for 1 missed cleavage was given, and charge states +2 and +3 were considered during data analysis. MS/MS spectra underwent further de novo sequencing using the PepNovo software (open source, available at http://proteomics.ucsd.edu/Software/PepNovo.html), followed by MS-BLAST validation. All procedures were conducted with the assistance of Protia and were performed exactly as detailed in our previous publication [20].
Gene expression analysis by real-time PCR
The expression of the 5 selected target genes was analyzed by real-time PCR, using 18S rDNA as the internal control. Total RNA from N. fowleri, A. castellanii, and B. mandrillaris was extracted with the RNeasy Mini Kit (Qiagen). cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Fermentas), following the manufacturer's instructions. Real-time PCR was performed on a Magnetic Induction Cycler PCR system (PhileKorea) according to a previously established protocol [21]: pre-incubation at 95°C for 1 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. All reaction mixtures were prepared using Luna Universal qPCR Master Mix (New England Biolabs), with specific primers listed in Table 1. The relative expression levels were calculated by normalizing the critical threshold (Ct) values to that of the internal control (18S rDNA), and graphs were presented using the 2^-ΔCt method.
Establishment of PAM mouse model and brain tissue collection
A total of 8 3-week-old female Balb/c mice were purchased from NARA Biotech. After a 1-week acclimation period, they were divided into a control group (n=4) and an infected group (n=4). Dexamethasone (Sigma-Aldrich) was administered intraperitoneally to the infected group at a dose of 5 mg/kg once daily for 4 consecutive days. Mice were then intranasally infected with 1×105 N. fowleri trophozoites in 50 µl PBS. They were monitored daily for clinical signs and mortality following N. fowleri infection.
Brains were collected from mice that either died or showed severe clinical deterioration, such as ruffled fur and marked reduction in mobility, following infection. Brains were also collected from control group mice. The brains were fixed in 4% paraformaldehyde (Yakuri Pure Chemicals) for 24 h, cryoprotected in 30% sucrose (Duksan Pure Chemicals), and subsequently embedded in OCT compound (Sigma-Aldrich), then stored at -80℃ until use.
Gene expression analysis of brain tissues by real-time PCR
Brains were sliced to a depth of 20 μm using a cryostat (Leica Microsystems). RNA was extracted from the brain tissues using the RNeasy FFPE Kit (Qiagen). cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Fermentas), following the manufacturer's instructions. Real-time PCR was performed as described above, using specific primers (Table 1). The relative expression levels were calculated by normalizing the Ct values to that of the control, and graphs were presented using the 2^-ΔCt method.
Statistical analysis
All statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software Inc.). Data are presented as mean±SD from 3 independent experiments. Statistical significance was assessed using Student t-test. P-values less than 0.05 were considered statistically significant and are denoted by asterisks (*P<0.05, **P<0.01).
Comparison of proteins between trophozoite lysates and conditioned media of N. fowleri
To identify Naegleria-preferentially secreted proteins, a comparison was made between trophozoite cell lysates (Fig. 1A) and conditioned media (Fig. 1B) of N. fowleri using 2-DE analysis. Protein spots were found to be weakly acidic, concentrating along the center of the pH 3–10 gradient strip (data not shown). Optimal protein spot distribution and resolution were achieved using a pH 4–7 strip and 10% SDS-PAGE (Fig. 1). The 2-DE analysis identified 24 proteins with differential expression in the conditioned media relative to the trophozoite lysates. The analysis revealed 1 increased protein (IN01), 5 decreased proteins (DE02 to DE06), 3 qualitative increased proteins (QI12 to QI14), and 15 qualitative decreased proteins (QD01 to QD15). Each protein spot was labeled with a number (Fig. 1C, D), and the number of spots classified by expression patterns was organized into a table (Fig. 1E).
Identification of N. fowleri–preferential proteins
LC-MS/MS analysis of proteins isolated from 2-DE gels identified various proteins derived from Naegleria spp. To search for sequence similarity matches specific to a taxonomy group or species, the UniProt (https://www.uniprot.org) and NCBI BLAST (https://blast.ncbi.nlm.nih.gov) databases were utilized. Of the 24 proteins that exhibited differential expression in the 2-DE analysis, 18 were confirmed to be proteins of N. fowleri (Table 2). According to NCBI BLAST results, among these 18 N. fowleri proteins, 15 were identified as hypothetical proteins, and 3 showed high similarity to fowlerpain-2. The protein analysis results for all spots are shown in Table 2.
Gene expression of 5 genes in N. fowleri by real-time PCR
From the Naegleria-preferential proteins identified in the 2-DE analysis, 5 proteins were selected based on their putative functions according to UniProt search results. These proteins were chosen to verify their preferential expression in N. fowleri among free-living amoebae. Primers targeting each gene were designed for the following proteins: p23-like domain–containing protein (p23), cystatin-like domain–containing protein (CYST), fowlerpain-2 (FLP), hemerythrin family non-heme iron protein (HLDP), and uncharacterized protein (UNCH). These along with the 18S reference gene, are listed in Table 1. The cDNA synthesized from total the RNA of N. fowleri, A. castellanii, and B. mandrillaris was subjected to real-time PCR. All 5 genes were found to be significantly expressed in N. fowleri and not in A. castellanii and B. mandrillaris (Fig. 2A-E). However, the CYST gene was observed to be slightly expressed in Acanthamoeba and Balamuthia (Fig. 2B).
Gene expression in PAM animal models by real-time PCR
To evaluate the potential of N. fowleri-preferentially secreted proteins as diagnostic candidates, PAM animal models were developed by infecting them with N. fowleri, and real-time PCR was performed using brain tissue (Fig. 3). All 4 mice with induced PAM succumbed to the infection between days 8 and 12, showing similar patterns of inflammation in the frontal brain regions (Fig. 3A, indicated by an arrow). RNA was extracted from the brain tissue of the PAM models, followed by cDNA synthesis. Real-time PCR was performed for the 5 mentioned protein genes, revealing significant overexpression of the p23-like domain-containing protein (p23) and fowlerpain-2 (FLP) in the PAM models. The p23-like domain-containing protein gene was overexpressed in PAM mice by 101.9, 81.2, 45.2, and 35.7 times compared to the control group (Fig. 3B). Similarly, the fowlerpain-2 protein gene was overexpressed by 27.7, 24.2, 47.8, and 23.0 times (Fig. 3C). The cystatin-like domain–containing protein, hemerythrin family non-heme iron protein, and uncharacterized protein genes were either not significantly expressed or showed large error margins in the brain tissue of the PAM model (data not shown).
Based on the comparative analysis of proteins though 2-DE analysis between trophozoite lysates and conditioned media of N. fowleri, 24 proteins with altered expression in conditioned media were identified. Further utilization of LC-MS/MS enabled the identification of 18 N. fowleri-preferential proteins. Gene expression analysis through real-time PCR provided additional evidence of the specificity of 5 proteins to N. fowleri.
Due to the lack of extensive database information on N. fowleri, the results of the LC-MS/MS analysis were searched for similarity using the UniProt and NCBI BLAST websites (Table 2). UniProt and NCBI BLAST are valuable bioinformatics resources with different, albeit related, purposes. NCBI BLAST is primarily used for sequence similarity searching, comparing a query sequence against a database to find homologous sequences and infer functional relationships. In contrast, UniProt is a comprehensive protein knowledgebase that integrates sequence, structure, function, and other relevant data. While UniProt also offers a BLAST tool for sequence similarity searches, its core function is to provide a curated and annotated resource for protein information. According to the NCBI BLAST results, most of the proteins identified by 2-DE analysis were classified as hypothetical proteins. However, in this study, 5 proteins were selected for further analysis based on their putative functions from the UniProt search results.
Spot QD06 was identified as a p23-like domain-containing protein, known to act as a co-chaperone of Hsp90 and facilitate the folding of various regulatory proteins [22]. However, since multiple Hsp90-encoding genes have been reported in the N. fowleri genome and none appear to be species-preferential, this protein was excluded from antibody development [23]. Spot QD09 corresponded to a protein containing a cystatin-like domain, classified within the cystatin family of cysteine protease inhibitors. These proteins typically consist of a single domain and are upregulated in brain tissue environments, where they suppress the activity of host cathepsins K and L, thereby enhancing parasite survival and pathogenicity [24]. Spots DE05, QI14, and QD15 were identified as fowlerpain-2, a cysteine protease secreted by N. fowleri that contributes to host tissue destruction, traversal of the blood–brain barrier, and invasion of the central nervous system [25]. Spot QD10 was a member of the hemerythrin family, which binds and consumes nitric oxide produced by macrophages, thus neutralizing nitric oxide–mediated amoebicidal mechanisms and promoting immune evasion [24]. Spot QD08 was an uncharacterized protein, and due to the lack of functional information, it was excluded from further investigation. To evaluate whether these genes were preferentially expressed in N. fowleri, real-time PCR analysis was conducted using A. castellanii and B. mandrillaris, 2 other free-living amoebae associated with encephalitis. All 5 genes were expressed at the highest levels in N. fowleri, while their expression in A. castellanii and B. mandrillaris was significantly lower or not expressed (Fig. 2). Among these, the genes for the p23-like domain-containing protein (QD06) and fowlerpain-2 (DE05, QI14, and QD15) were significantly overexpressed in the brain tissue of the PAM mouse model (Fig. 3). Based on these results, the proteins corresponding to spots DE05, QI14, and QD15 were selected as N. fowleri-preferentially secreted proteins, and further research is underway.
In previous studies exploring the secreted pathogenic proteins of A. castellanii, a wide variety of secreted proteins were identified through 2-DE analysis [20]. However, in this study, the number of secreted proteins identified in N. fowleri was much smaller than expected. This was likely due to our use of serum-free conditioned media, which was employed to minimize strong background signals caused by residual fetal bovine serum proteins. However, the serum-free conditions may have compromised the physiological activity of N. fowleri, leading to reduced protein secretion and a consequent decrease in the number of detectable spots. As a result, the range of candidate proteins available for screening of N. fowleri–preferentially secreted proteins was limited. Further studies should focus on optimizing culture conditions to enhance secreted protein yield and validate the diagnostic utility of the selected proteins in clinical and experimental models. Meanwhile, some protein genes showed non-significant or highly variable real-time PCR results in the brain tissue of the PAM animal model (data not shown). This variability may be influenced by differences in the severity of PAM symptoms and the specific brain regions sampled. To address this, further validation of PCR results in a larger number of PAM animal models is warranted.
In summary, the comprehensive proteomic and gene expression analyses of N. fowleri provide a foundational understanding of its secretome and highlight potential targets for the development of antibody-based and molecular biological diagnostic methods. Further studies should focus on the functional characterization of identified proteins to enhance our understanding of N. fowleri biology and to develop strategies to combat infections caused by free-living amoebae including N. fowleri.

Author contributions

Conceptualization: Moon EK. Data curation: Lee HA, Quan FS, Kong HH, Moon EK. Funding acquisition: Moon EK. Investigation: Jo HJ, Lee HA, Moon EK. Methodology: Jo HJ, Lee HA, Quan FS, Kong HH, Moon EK. Validation: Moon EK. Writing – original draft: Jo HJ. Writing – review & editing: Lee HA, Quan FS, Kong HH, Moon EK.

Conflict of interest

Fu-Shi Quan serves as an editor of Parasites, Hosts and Diseases but had no involvement in the decision to publish this article. No other potential conflicts of interest relevant to this study were reported.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (RS-2024-00346635).

Fig. 1.
Two-dimensional gel electrophoresis of proteins in Naegleria fowleri lysates and conditioned media. A comparison of proteins between trophozoite lysates (A) and conditioned media (B) revealed 24 proteins with differential expression. Each protein spot was labeled with a number indicating whether the protein was increased (IN), decreased (DE), qualitative increased (QI), or qualitative decreased (QD) in the conditioned media compared to the trophozoite lysates (C, D). The number of spots classified by expression patterns was organized into a table (E). MW: molecular weight.
PHD-25058f1.jpg
Fig. 2.
Real-time PCR for mRNA quantitation. Real-time PCR was performed on cDNA synthesized from the total RNA of Naegleria fowleri (Nf), Acanthamoeba castellanii (Ac), and Balamuthia mandrillaris (Bm). The relative expression levels were normalized to the 18S rDNA of each sample and calculated using the formula 2^−ΔCt (where ΔCt = Ct_target − Ct_18S). Bars represent the mean±SD (n=3). The p23-like domain–containing protein (p23), cystatin-like domain–containing protein (CYST), fowlerpain-2 (FLP), hemerythrin family non-heme iron protein (HLDP), and uncharacterized protein (UNCH) each exhibited their highest expression in N. fowleri (A-E). Data are expressed as mean±SD, and asterisks denote statistically significant differences between the target gene and 18S rDNA (**P<0.01).
PHD-25058f2.jpg
Fig. 3.
Detection of Naegleria fowleri–preferential proteins in primary amebic meningoencephalitis (PAM) animal models. PAM animal models were developed by infecting them with N. fowleri (A, indicated by an arrow), and real-time PCR was performed using cDNA synthesized from the total RNA of brain tissue (B, C). The p23-like domain-containing protein and the fowlerpain-2 gene were significantly overexpressed in PAM brain tissue compared to the control group. Naïve refers to the brain of the negative control group (N), and PAM refers to the brain of the N. fowleri–infected group (P). Data are expressed as mean±SD, and asterisks denote statistical significance between the means of the 2 groups (**P<0.01).
PHD-25058f3.jpg
Table 1.
Primer sequences for real-time PCR
Table 1.
No. Group ID Product Primer sequences (5’→3’)
1 QD06 Hypothetical protein (p23_like domain) F: GTGGACTGGTCGAAATGGGT
R: CCTCCTCTTCTTCATCACCCG
2 QD09 Hypothetical protein (cystatin-like domain) F: GAACAAAAGCTCGGCAAGACA
R: CTCACCTGTCTTGACGCCAT
3 DE05, QI14, QD15 Fowlerpain-2 (cysteine protease) F: AGTGGATCATTGGCTGGTGG
R: TCCAAACCCCAGTCAACTCC
4 QD10 Hypothetical protein (hemerythrin family non-heme iron protein) F: CTGGGACTCTTCTTTCTGCGT
R: TGCGAACAAGTCCTCCTCAG
5 QD08 Uncharacterized protein F: GTTCCTTCACTGGAGGCTCA
R: ACTGGTGAGAAGAAGAAGAATTTGC
6 Control_Nf Naegleria fowleri 18S rDNA F: GGAGAGGGAGCCTGAGAGAT
R: CTGGCACCAGACTTTTCCTC
7 Control_Ac Acanthamoeba castellanii 18S rDNA F: CGTGCTGGGGATAGATCATT
R: AAAGGGGAGACCTCACAACC
8 Control_Bm Balamuthia mandrillaris 18S rDNA F: TGACTCAACACGGGGAAACT
R: TCACCCCCTGGTTTTGAATA
Table 2.
Secreted proteins from Naegleria fowleri trophozoites
Table 2.
No. Group ID Uniprot NCBI Score Mass (Da)
Name Accession No. Name Accession No.
1 IN01 Profilin tr|A0A6A5BHQ3|A0A6A5BHQ3_NAEFO Hypothetical protein FDP41_006373 [Naegleria fowleri] KAF0974341.1 126 14,000
2 DE02 Triosephosphate isomerase tr|A0A6A5BWU3|A0A6A5BWU3_NAEFO Hypothetical protein FDP41_012394 [N. fowleri] KAF0981737.1 324 27,879
3 DE03 Triosephosphate isomerase tr|A0A6A5BWU3|A0A6A5BWU3_NAEFO Hypothetical protein FDP41_012394 [N. fowleri] KAF0981737.1 137 27,879
4 DE04 Uncharacterized protein tr|A0AA88KE97|A0AA88KE97_NAELO Hypothetical protein C9374_009233 [N. lovaniensis] KAG2377322.1 27 108,339
5 DE05 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [N. fowleri] AKC55968.1 751 34,550
6 DE06 Uncharacterized protein tr|A0AAW2Z485|A0AAW2Z485_9EUKA Hypothetical protein AKO1_013992 [N. fowleri] KAL0483734.1 23 42,132
7 QI12 Histidine kinase tr|D2VZJ1|D2VZJ1_NAEGR Predicted protein [N. gruberi] EFC37856.1 18 61,785
8 QI13 NUC153 domain-containing protein tr|A0A6A5CCI8|A0A6A5CCI8_NAEFO Hypothetical protein FDP41_007451 [N. fowleri] KAF0984274.1 21 93,035
9 QI14 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [Naegleria fowleri] AKC55968.1 794 34,550
10 QD01 ABC transporter protein ARB1 tr|A0AAW2YMA9|A0AAW2YMA9_9EUKA ABC transporter protein ARB1 [Acrasis kona] KAL0478427.1 21 66,226
11 QD02 Carboxypeptidase tr|A0A6A5CIS9|A0A6A5CIS9_NAEFO Hypothetical protein FDP41_000254 [N. fowleri] KAF0985215.1 67 56,379
12 QD03 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 96 214,996
13 QD04 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 116 214,996
14 QD05 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 35 214,996
15 QD06 CS domain-containing protein tr|A0A6A5BBV5|A0A6A5BBV5_NAEFO Hypothetical protein FDP41_006609 [N. fowleri] KAF0974577.1 189 20,010
16 QD07 Uncharacterized protein tr|A0A6A5BFT0|A0A6A5BFT0_NAEFO Hypothetical protein FDP41_003988 [N. fowleri] KAF0976693.1 60 18,525
17 QD08 Uncharacterized protein tr|A0A6A5BFT0|A0A6A5BFT0_NAEFO Hypothetical protein FDP41_003988 [N. fowleri] KAF0976693.1 130 18,525
18 QD09 Cystatin domain-containing protein tr|A0A6A5BX69|A0A6A5BX69_NAEFO Hypothetical protein FDP41_002161 [N. fowleri] KAF0979091.1 157 10,408
19 QD10 Hemerythrin-like domain-containing protein tr|A0A6A5BCB0|A0A6A5BCB0_NAEFO Hypothetical protein FDP41_010118 [N. fowleri] KAF0971589.1 1,750 13,452
20 QD11 Uncharacterized protein tr|A0AAW2Z485|A0AAW2Z485_9EUKA Hypothetical protein AKO1_013992 [A. kona] KAL0483734.1 36 42,132
21 QD12 Glutamyl-tRNA reductase tr|A0AAW2YMP3|A0AAW2YMP3_9EUKA Glutamyl-tRNA reductase [A. kona] KAL0478153.1 16 31,447
22 QD13 Predicted protein tr|D2VNK6|D2VNK6_NAEGR Predicted protein [N. gruberi] EFC41752.1 29 59,920
23 QD14 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 25 214,996
24 QD15 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [N. fowleri] AKC55968.1 250 34,550

IN, increased; DE, decreased; QI, qualitative increased; QD, qualitative decreased.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri
Parasites Hosts Dis. 2026;64(1):27-36.   Published online January 26, 2026
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri
Parasites Hosts Dis. 2026;64(1):27-36.   Published online January 26, 2026
Close

Figure

  • 0
  • 1
  • 2
Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri
Image Image Image
Fig. 1. Two-dimensional gel electrophoresis of proteins in Naegleria fowleri lysates and conditioned media. A comparison of proteins between trophozoite lysates (A) and conditioned media (B) revealed 24 proteins with differential expression. Each protein spot was labeled with a number indicating whether the protein was increased (IN), decreased (DE), qualitative increased (QI), or qualitative decreased (QD) in the conditioned media compared to the trophozoite lysates (C, D). The number of spots classified by expression patterns was organized into a table (E). MW: molecular weight.
Fig. 2. Real-time PCR for mRNA quantitation. Real-time PCR was performed on cDNA synthesized from the total RNA of Naegleria fowleri (Nf), Acanthamoeba castellanii (Ac), and Balamuthia mandrillaris (Bm). The relative expression levels were normalized to the 18S rDNA of each sample and calculated using the formula 2^−ΔCt (where ΔCt = Ct_target − Ct_18S). Bars represent the mean±SD (n=3). The p23-like domain–containing protein (p23), cystatin-like domain–containing protein (CYST), fowlerpain-2 (FLP), hemerythrin family non-heme iron protein (HLDP), and uncharacterized protein (UNCH) each exhibited their highest expression in N. fowleri (A-E). Data are expressed as mean±SD, and asterisks denote statistically significant differences between the target gene and 18S rDNA (**P<0.01).
Fig. 3. Detection of Naegleria fowleri–preferential proteins in primary amebic meningoencephalitis (PAM) animal models. PAM animal models were developed by infecting them with N. fowleri (A, indicated by an arrow), and real-time PCR was performed using cDNA synthesized from the total RNA of brain tissue (B, C). The p23-like domain-containing protein and the fowlerpain-2 gene were significantly overexpressed in PAM brain tissue compared to the control group. Naïve refers to the brain of the negative control group (N), and PAM refers to the brain of the N. fowleri–infected group (P). Data are expressed as mean±SD, and asterisks denote statistical significance between the means of the 2 groups (**P<0.01).
Exploration of Naegleria-preferentially secreted proteins for identifying diagnostic candidates to detect Naegleria fowleri
No. Group ID Product Primer sequences (5’→3’)
1 QD06 Hypothetical protein (p23_like domain) F: GTGGACTGGTCGAAATGGGT
R: CCTCCTCTTCTTCATCACCCG
2 QD09 Hypothetical protein (cystatin-like domain) F: GAACAAAAGCTCGGCAAGACA
R: CTCACCTGTCTTGACGCCAT
3 DE05, QI14, QD15 Fowlerpain-2 (cysteine protease) F: AGTGGATCATTGGCTGGTGG
R: TCCAAACCCCAGTCAACTCC
4 QD10 Hypothetical protein (hemerythrin family non-heme iron protein) F: CTGGGACTCTTCTTTCTGCGT
R: TGCGAACAAGTCCTCCTCAG
5 QD08 Uncharacterized protein F: GTTCCTTCACTGGAGGCTCA
R: ACTGGTGAGAAGAAGAAGAATTTGC
6 Control_Nf Naegleria fowleri 18S rDNA F: GGAGAGGGAGCCTGAGAGAT
R: CTGGCACCAGACTTTTCCTC
7 Control_Ac Acanthamoeba castellanii 18S rDNA F: CGTGCTGGGGATAGATCATT
R: AAAGGGGAGACCTCACAACC
8 Control_Bm Balamuthia mandrillaris 18S rDNA F: TGACTCAACACGGGGAAACT
R: TCACCCCCTGGTTTTGAATA
No. Group ID Uniprot NCBI Score Mass (Da)
Name Accession No. Name Accession No.
1 IN01 Profilin tr|A0A6A5BHQ3|A0A6A5BHQ3_NAEFO Hypothetical protein FDP41_006373 [Naegleria fowleri] KAF0974341.1 126 14,000
2 DE02 Triosephosphate isomerase tr|A0A6A5BWU3|A0A6A5BWU3_NAEFO Hypothetical protein FDP41_012394 [N. fowleri] KAF0981737.1 324 27,879
3 DE03 Triosephosphate isomerase tr|A0A6A5BWU3|A0A6A5BWU3_NAEFO Hypothetical protein FDP41_012394 [N. fowleri] KAF0981737.1 137 27,879
4 DE04 Uncharacterized protein tr|A0AA88KE97|A0AA88KE97_NAELO Hypothetical protein C9374_009233 [N. lovaniensis] KAG2377322.1 27 108,339
5 DE05 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [N. fowleri] AKC55968.1 751 34,550
6 DE06 Uncharacterized protein tr|A0AAW2Z485|A0AAW2Z485_9EUKA Hypothetical protein AKO1_013992 [N. fowleri] KAL0483734.1 23 42,132
7 QI12 Histidine kinase tr|D2VZJ1|D2VZJ1_NAEGR Predicted protein [N. gruberi] EFC37856.1 18 61,785
8 QI13 NUC153 domain-containing protein tr|A0A6A5CCI8|A0A6A5CCI8_NAEFO Hypothetical protein FDP41_007451 [N. fowleri] KAF0984274.1 21 93,035
9 QI14 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [Naegleria fowleri] AKC55968.1 794 34,550
10 QD01 ABC transporter protein ARB1 tr|A0AAW2YMA9|A0AAW2YMA9_9EUKA ABC transporter protein ARB1 [Acrasis kona] KAL0478427.1 21 66,226
11 QD02 Carboxypeptidase tr|A0A6A5CIS9|A0A6A5CIS9_NAEFO Hypothetical protein FDP41_000254 [N. fowleri] KAF0985215.1 67 56,379
12 QD03 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 96 214,996
13 QD04 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 116 214,996
14 QD05 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 35 214,996
15 QD06 CS domain-containing protein tr|A0A6A5BBV5|A0A6A5BBV5_NAEFO Hypothetical protein FDP41_006609 [N. fowleri] KAF0974577.1 189 20,010
16 QD07 Uncharacterized protein tr|A0A6A5BFT0|A0A6A5BFT0_NAEFO Hypothetical protein FDP41_003988 [N. fowleri] KAF0976693.1 60 18,525
17 QD08 Uncharacterized protein tr|A0A6A5BFT0|A0A6A5BFT0_NAEFO Hypothetical protein FDP41_003988 [N. fowleri] KAF0976693.1 130 18,525
18 QD09 Cystatin domain-containing protein tr|A0A6A5BX69|A0A6A5BX69_NAEFO Hypothetical protein FDP41_002161 [N. fowleri] KAF0979091.1 157 10,408
19 QD10 Hemerythrin-like domain-containing protein tr|A0A6A5BCB0|A0A6A5BCB0_NAEFO Hypothetical protein FDP41_010118 [N. fowleri] KAF0971589.1 1,750 13,452
20 QD11 Uncharacterized protein tr|A0AAW2Z485|A0AAW2Z485_9EUKA Hypothetical protein AKO1_013992 [A. kona] KAL0483734.1 36 42,132
21 QD12 Glutamyl-tRNA reductase tr|A0AAW2YMP3|A0AAW2YMP3_9EUKA Glutamyl-tRNA reductase [A. kona] KAL0478153.1 16 31,447
22 QD13 Predicted protein tr|D2VNK6|D2VNK6_NAEGR Predicted protein [N. gruberi] EFC41752.1 29 59,920
23 QD14 Dopey N-terminal domain-containing protein tr|A0A6A5C095|A0A6A5C095_NAEFO Hypothetical protein FDP41_001661 [N. fowleri] KAF0979318.1 25 214,996
24 QD15 Fowlerpain-2 tr|A0A1L1XWF9|A0A1L1XWF9_NAEFO Fowlerpain-2 [N. fowleri] AKC55968.1 250 34,550
Table 1. Primer sequences for real-time PCR
Table 2. Secreted proteins from Naegleria fowleri trophozoites

IN, increased; DE, decreased; QI, qualitative increased; QD, qualitative decreased.